Received 2019-06-15

Revised 2021-10-22

Accepted 2022-05-24

Introduction

Nowadays, the use of medicinal herbs and traditional medicine in the treatment of diseases has attracted the attention of many researchers [1-3]. Ziziphi Spinosae Semen (SZS) the seeds of Ziziphus jujuba Mill var. Spinosa belongs to the Rhamnaceae family has been used for more than a thousand years as a sedative drug in the pharmacopeia of China, Japan, Korea, and other Eastern countries [4]. Various studies have shown the role of SZS in several activities, including the hypnotic-sedative, antihypertensive, antihyperlipidemic, and anti-inflammatory effects. Moreover, some studies have reported the psychological and anti-anxiety effects of this substance [5, 6]. In addition, the anti-apoptotic effect of this substance has been proven in the study [7].

Stroke is the most common and debilitating neurologic lesion and is the third most common cause of death after heart disease and cancer [8-10]. This disease can be caused by the closure or rupture of one of the blood vessels of the brain. These lesions may lead to permanent disabilities, including impaired motor skills, communication, cognition, memory, and learning. Therefore, stroke decreases the quality of life and burdens the family and society [10]. Usually, there are no warning signs before the stroke and/or only minor symptoms are observed. The risk of developing cerebral embolism, thrombosis, and hemorrhage increases with elevated blood pressure. Typically, 85% of strokes are ischemic, and 15% are hemorrhagic [10, 11].

Since the hippocampus is stocked by the anterior choroidal artery, which is a split of the internal carotid artery, it is always prone to thrombosis due to being long and thin. Therefore, the hippocampus is one of the main zones of the marrow that can be damaged in brain diseases such as stroke and
ischemia [12]. One of the most sensitive parts of this region is the CA1 hippocampal pyramidal neurons, which have a high sensitivity to ischemia [13]. Therefore, temporary or permanent reduction of blood flow to the brain causes processes such as cytotoxicity induced by stimulation, acidosis, ion imbalance, oxidative stress, reactive oxygen species (ROS) production, lipid peroxidation, inflammation, and cell apoptosis [14, 15].

The identification of factors that reduce ischemia has always been of interest to researchers, and the use of natural substances and compounds derived from medicinal plants has been precious due to low levels of complications [13-15].

Jujuboside A is a mixture of triterpene glycosides derived from SZS [16]. Previous studies showed Jujuboside A has antioxidant properties and can eliminate cellular ROS [17, 18]. Neurons are highly susceptible to acute oxidative and metabolism stress under ischemic conditions [19]. This may be can induce apoptosis in neuronal cells. Therefore, the use of antioxidants as neuroprotective elements that reduce apoptotic mediators and are the stimuli of neuronal growth may have positive effects on the prevention of ischemic stroke and improving the patients who suffer from ischemic stroke [11, 20]. Many studies highlighted the role of Jujuboside A on ischemic neurons as a potent antioxidant [17, 18]. However, the definitive effect of this substance on the change in the expression of the neuroprotective genes has not been identified. Hence, this study aimed to investigate the effect of Jujuboside A on the proliferation-inducing gene expression and cell enhancement on the hippocampus of male Wistar rats after the induction of transient global ischemia/reperfusion (I/R).

Materials and Methods

Study Design

Twenty-four male Wistar rats (around eight weeks of age and weighing 230±30 g) were used in this study. Animals were kept in plexiglass cages and a room with a temperature of 23±2 °C, relative humidity of 50 to 55%, 12-hour darkness/light cycle with free access to water and food [3]. Two weeks were considered for adaptation to environmental conditions.

Animals were randomly divided into four groups (n=6 per group) as follows:

1. Control group that received no any treatment

2. Ischemia group that underwent transient global I/R for 20 minutes after being anesthetized

3. Treatment group that received 20 μg/kg Jujuboside A (Sigma, Germany) by intraperitoneal (IP) injection 30 minutes before ischemia

4. Vehicle group that received dimethyl sulfoxide 0.3% (DMSO; Sigma, Germany) as the vehicle material through IP injection 30 minutes before ischemia at a volume similar to the treatment group. For anesthesia, ketamine (80 mg/Kg) and xylazine (8 mg/Kg) were administered by IP injection.

All animals were under human caring in accordance with the Principles for the Care and Use of Animals in Research and approved by the ethics committee of Tehran Medical Sciences, Islamic Azad University (code of ethical approval: IR.IAU.PS.REC.1400.182).

Induction of Transient Global I/R

Induction of transient global ischemia/reperfusion was as described previously [21]. After exerting the midline incision on the neck, left and right carotid arteries were isolated and separated from the vagus nerve, and then carotid arteries were occluded by microsurgical clamps. Simultaneously hypotension (blood pressure=50 mmHg) was induced by withdrawing blood via the femoral artery. After 20 minutes, the clamps were opened, the blood flow was restored, and the withdrawn blood was re-infused. During the surgical procedure, the temperature of the animal's body was maintained at 37.5 °C by a thermal towel. At the end of the ischemia, the incision was closer by suture thread, and the animals were kept under observation until they were awake and were then kept in separate cages. Three days after ischemia, the animals were anesthetized using ether (inhalation), and immediately after cutting off their head, the hippocampus was separated. Samples were stored at -80 °C.

RNA Extraction and cDNA Synthesis

According to the manual’s protocol, the TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) was used for the total RNA extraction from samples. After that, the DNase was applied to remedy all RNA samples. A kit of cDNA synthesis (Yektatajhiz cDNA synthesis kit, Iran) was applied to the synthesis of total cDNA according to the instructions of the manufacture. The proprietary primers were applied to amplify the cDNA for NFκB (nuclear factor kappa-light-chain-enhancer of activated B cells), nerve growth factor (NGF), and Brain-derived neurotrophic factor (BDNF). The glyceraldehyde-3-phosphate dehydrogenase (GHPD) was used for normalization as an internal control. The fast real-time polymerase chain reaction (PCR) System (Biosystems 7500, Thermo Fisher Scientific, USA) was applied in combination with the SYBR Premix Ex Taq II kit (Takara Bio, Iran) to amplify the ensuing cDNA.

Real-Time PCR

The sequences of proprietary primer were applied as follows (from 5´ to 3´): NFκB, forward (F): CATACGCTGACCCTAGCCTG, reverse (R): TTTCTTCAATCCGGTGGCGA (135 bp); NGF, F: ATCGCTCTCCTTCACAGAGTT; R: CGCTATGCACCTCAGAGTGG (151 bp); BDNF, F: AATAATGTCTGACCCCAGTGCC; R: TTGTTGTCACGCTCCTGGTC (276 bp) under the following reaction conditions: initial denaturation in 30 seconds at 96 °C, followed by 40 cycles of 20 seconds at
95 °C, 20 seconds at 60 °C, and 30 seconds at 72 °C. The 2-DDCt formula was used for the measurement of the relative quantification of the gene expression levels.

Statistical Analysis

The results were analyzed using SPSS software version 16 (SPSS Inc., Chicago IL, USA). Descriptive data were composed of the frequency distribution central indexes, distribution, and percentages. Continuous quantitative data were compared between the different groups using the ANOVA and Tukey's post hoc test, and correlation was used to compare the discrete data between the groups. A P-value lower than 0.05 was considered as statistically significant.

Results

The results of this study showed that the mean relative expression of NFκB gene in the control group was 1.104±0.25. However, the mean relative expression in the ischemic, DMSO, and Jujuboside A groups were 1.141±0.08, 1.025±0.006, and 1.012±0.04, respectively. Also, the expression of NFκB gene in the Jujuboside A group was lower than in the other groups. However, there was no significant difference between the groups in terms of relative expression of NFκB gene (P>0.05, Figure-1).

Regarding Figure-2, the expression of BDNF in control, ischemic, DMSO, and Jujuboside A groups were 0.724±0.01, 0.734±0.011, 0.762±0.008, and 0.74±0.02, respectively. The results of statistical analysis showed no significant difference in the expression of the BDNF gene between the studied groups (P>0.05, Figure-2).

Also, the expression of NGF in control, ischemic, DMSO, and Jujuboside A groups were 0.575±0.035, 0.535±0.003, 0.69±0.036, and 0.699±0.026, respectively (Figure-3). The ANOVA test showed a significant difference between DMSO, Jujuboside A, and ischemic groups in terms of the expression of NGF (P<0.05); the gene expression in DMSO and Jujuboside A groups increased significantly compared with ischemic group (Figure-3).

Discussion

This study showed that Jujuboside A
injection before cerebral I/R caused a protective effect on the hippocampus by increasing the expression of some of the neuroprotective genes. Studies have shown that transient global I/R delays the death of nerve cells in sensitive regions of the central nervous system, such as the hippocampal CA1 region [17, 18]. Oxidative stress is a major challenge in ischemia caused by a lack of blood supply to the organs and ultimately leads to the production of free radicals such as ROS and RNA [22, 23]. In recent years, much attention has been paid to the role of antioxidants in preventing the complications of brain damage after
stroke [14, 15]. In addition, identifying factors that change the expression of protective genes and cellular growth can be very useful.
NF-κB, NGF, and BDNF are among the genes that are highly involved in the cell proliferation pathway and the growth of nerve cells. These genes effectively control the transcription of DNA, cytokine production, proliferation, and survival of nerve cells (neurons) [24]. In addition, these genes promote the development of the neural network [24, 25]. The role of Jujuboside A as a strong antioxidant has been mentioned in some studies [5, 6, 17, 18].

The current study showed that NGF expression in the hippocampus after transient global I/R was significantly higher in the Jujuboside A group compared with the ischemic group. However, the expression of this gene in the control group was more than that of the ischemic group. In other words, 20 minutes of cerebral I/R reduced the expression of NGF from the cells of the hippocampal CA1 region, which was significantly increased by the Jujuboside A injection. This suggests that Jujuboside A injection can decrease degenerated neurons (unpublished data) and increase the expression of the genes to repair the cells. In addition, the level of BDNF expression in the treatment group increased compared to the ischemic group, which could be effective in improving the ischemic changes.

In a study by Han et al. [18] that investigated the protective effects and potential mechanism of Jujuboside A on isoproterenol-induced cardiomyocytes injury, it was concluded that Jujuboside A pretreatment could increase cell viability and improve injury in H9C2 cells induced by Isoproterenol. Moreover, they showed that Jujuboside A could sharpen the mTOR, Akt, and PI3K phosphorylation [18]. Therefore, they indicated that Jujuboside A could reduce cellular damage by phosphorylation of PI3K, Akt, and
mTOR [18].

Wang et al. [26] showed that Jujuboside A has a suppressive effect on the involuntary actions of the mouse through the Rpgrip1 (retinitis pigmentosa transcription factor regulated GTPase regulator interacting protein1) and Mark3 (MAP/microtubule affinity-regulating kinase3) in the hippocampus.

The NGF is mostly preoccupied with the growth, preservation, proliferation, and permanence of nervous cells. In fact, the NGF is decretory for the permanence and preservation of sympathetic and sensory nerve cells, as they shift to programmed cell death in its lack [27]. However, some evidancs propose that the NGF also regulates the cycle cell of nervous cells by involved pathways [28]. The NGF activity is due to two types of receptors that are related to the neurodegenerative disturbance; the low-affinity NGF receptor (LNGFR/p75NTR) and tropomyosin receptor kinase A (TrkA) [29]. Accordingly, NGF via some pathways could stimulate intracellular factors that increase the survival of NGF-mediated nerve cells. Although in the lack of NGF, the expression of the apoptotic protein is enhanced, stimulation of c-Jun (the transcription factors of apoptosis) is done when all the NGF-mediated pathways are blocked [30-32].

Furthermore, NGF can lead to the expression of some genes by binding to the TrkA receptor, such as bcl-2, which stimulates the survival and proliferation of the neuron
cell [30, 31, 33].

High-affinity interactions between pro-NGF, p75NTR, and sortilin may lead to either survival or apoptosis [34]. Also,
NF-κB controls nuclear gene transcription to reinforce cell survival [24, 25]. Otherwise, apoptosis occurs when both NRIF and TRAF6 are engaged in c-Jun N-terminal kinase activation, which c-Jun phosphorylates. The operated transcription factor c-Jun reconciles nuclear transcription via AP-1 to raise pro-apoptotic gene expression [35, 36].

Therefore, it seems that due to its effect on the signaling pathway resulting from the expression of the NGF gene, Jujuboside A has a neuroprotective effect on the hippocampus after transient global I/R and can survive damaged neurons.

Conclusion

The results of this study show that Jujuboside A can increase the expression of NGF by repairing the hippocampus after transient global I/R. In other words, Jujuboside A can prevent negative changes in the hippocampus via increased BDNF expression.

Acknowledgment

This work was supported by Tehran Medical Sciences, Islamic Azad University.

Conflict of Interest

The author(s) indicated no conflicts of interest.

 Correspondence to: Shabnam Movassaghi, Department of Anatomical Sciences and Cognitive Neuroscience, Tehran Medical Sciences, Islamic Azad University, Tehran, Iran Telephone Number: +989122175723 Email Address: shmovasaghi@iautmu.ac.ir

Figure 1. The mean relative expression of NFκB gene in control, ischemic, vehicle, and Jujuboside A groups.

Figure 2. The mean relative expression of the BDNF gene in control, ischemic, DMSO (vehicle), and
Jujuboside A groups.

Figure 3. The mean relative expression of the NGF gene in control, ischemic, DMSO, and Jujuboside A groups. * P<0.05 vs. ischemia group

References

1. Abbasi Gamasaee N, Radmansouri M, Ghiasvand S, Shahriari F, Zare Marzouni H, Aryan H, et al. Hypericin Induces Apoptosis in MDA-MB-175-VII Cells in Lower Dose Compared to MDA-MB-231. Arch Iran Med. 2018;21(9):387-92.
2. Kooti W, Servatyari K, Behzadifar M, Asadi-Samani M, Sadeghi F, Nouri B, Zare Marzouni H. Effective Medicinal Plant in Cancer Treatment, Part 2: Review Study. J Evid Based Complementary Altern Med. 2017;22(4):982-95.
3. Rafiee S, Nekouyian N, Hosseini S, Sarabandi F, Chavoshi-Nejad M, Mohsenikia M, et al. Effect of topical linum usitatissimum on full thickness excisional skin wounds. Trauma Mon. 2017;22(6):e64930.
4. Jeong EJ, Lee HK, Lee KY, Jeon BJ, Kim DH, Park JH, et al. The effects of lignan-riched extract of Shisandra chinensis on amyloid-β-induced cognitive impairment and neurotoxicity in the cortex and hippocampus of mouse. J Ethnopharmacol. 2013;146(1):347-54.
5. You ZL, Xia Q, Liang FR, Tang YJ, Xu CL, Huang J, et al. Effects on the expression of GABAA receptor subunits by jujuboside a treatment in rat hippocampal neurons. J Ethnopharmacol. 2010;128(2):419-23.
6. Chen CJ LM, Wang XL, Fang FF, Ling CQ. Effect of Sour Date (Semen ziziphi spinosae) Seed Extract on Treating Insomnia and Anxiety. In: Nuts and Seeds in Health and Disease Prevention. Academic Press; 2011. p. 1037-43.
7. Huang YS, Pan YY, Jia YH. A study of anti-apoptosis effect and mechanism of Jujuboside A in hydrogen peroxide damaged myocardial cell. Liaoning Journal of Traditional Chinese Medicine. 2011;38(3):454-5.
8. Marzouni HZ, Bagherabad MB, Sharaf S, Zarrinkamar M, Shaban S, Aryan H, et al. Thioredoxin Reductase Activity and Its Tissue Distribution in the Pathologic Specimens of Patients with Laryngeal Squamous Cell Carcinoma. GMJ. 2016;5(3):153-59.
9. Zare Marzouni H, Lavasani Z, Shalilian M, Najibpour R, Saadat Fakhr M, Nazarzadeh R, et al. Women's Awareness and Attitude Toward Breast Self-Examination in Dezful City, Iran, 2013. Iran Red Crescent Med J. 2014;17(1):e17829.
10. Mozaffarian D, Benjamin EJ, Go AS, Arnett DK, Blaha MJ, Cushman M, et al. Heart disease and stroke statistics-2016 update a report from the American Heart Association. Circulation. 2016;133(4):e38-360.
11. Zhang S, Qi Y, Xu Y, Han X, Peng J, Liu K, Sun CK. Protective effect of flavonoid-rich extract from Rosa laevigata Michx on cerebral ischemia-reperfusion injury through suppression of apoptosis and inflammation. Neurochem Int. 2013;63(5):522-32.
12. Dekeyzer S, De Kock I, Nikoubashman O, Vanden Bossche S, Van Eetvelde R, De Groote J, et al. "Unforgettable" - a pictorial essay on anatomy and pathology of the hippocampus. Insights Imaging. 2017;8(2):199-12.
13. Morioka T, Kalehua A, Streit W. Progressive expression of immunomolecules on microglial cells in rat dorsal hippocampus following transient forebrain ischemia. Acta Neuropathol. 1992;83(2):149-57.
14. Lakhan SE, Kirchgessner A, Hofer M. Inflammatory mechanisms in ischemic stroke: therapeutic approaches. J Transl Med. 2009;7(1):97.
15. Shenoda B. The role of Na+/Ca2+ exchanger subtypes in neuronal ischemic injury. Transl Stroke Res. 2015;6(3):181-90.
16. Liu Z, Zhao X, Liu B, Liu A-j, Li H, Mao X, et al. Jujuboside A, a neuroprotective agent from semen Ziziphi Spinosae ameliorates behavioral disorders of the dementia mouse model induced by Aβ1–42. Eur J Pharmacol. 2014;738:206-13.
17. Yoo KY, Li H, Hwang IK, Choi JH, Lee CH, Kwon DY, et al. Zizyphus attenuates ischemic damage in the gerbil hippocampus via its antioxidant effect. J Med Food. 2010;13(3):557-63.
18. Han D, Wan C, Liu F, Xu X, Jiang L, Xu J. Jujuboside A Protects H9C2 Cells from Isoproterenol-Induced Injury via Activating PI3K/Akt/mTOR Signaling Pathway. Evid Based Complement Alternat Med. 2016; 2016:1-8.
19. Menzies FM, Ince PG, Shaw PJ. Mitochondrial involvement in amyotrophic lateral sclerosis. Neurochem Int. 2002;40(6):543-51.
20. Belousova MA, Korsakova EA, Gorodetskaia EA, Kalenikova EI, Medvedev OS. New antioxidants as neuroprotective agents for the treatment of ischemic brain injury and neurodegenerative diseases. Eksp Klin Farmakol. 2014;77(11):36-44.
21. Jangholi E, Sharifi ZN, Hoseinian M, Zarrindast MR, Rahimi HR, Mowla A, et al. Verapamil inhibits mitochondria-induced reactive oxygen species and dependent apoptosis pathways in cerebral transient global ischemia/reperfusion. Oxid Med Cell Longev. 2020;2020:5872645.
22. Marzouni HZ, Tarkhan F, Aidun A, Shahzamani K, Tigh HRJ, Malekshahian S, et al. Cytotoxic Effects of Coated Gold Nanoparticles on PC12 Cancer Cell. GMJ. 2018;7:e1110.
23. Shahzamani K, Zare Marzouni H, Tarkhan F, Lashgarian H. A Study of Mechanism and Rate of PC12 Cancer Cell Destruction Induced by Lysine-Coated Gold Nanoparticle. Journal of Babol University of Medical Sciences. 2016;18(8):41-7.
24. Olmez I, Zhang Y, Manigat L, Benamar M, Brenneman B, Nakano I, et al. Combined c-met/Trk inhibition overcomes resistance to CDK4/6 inhibitors in glioblastoma. Cancer Res. 2018;78(15):4360-9.
25. Caviedes A, Lafourcade C, Soto C, Wyneken U. BDNF/NF-κB signaling in the neurobiology of depression. Curr Pharm Des. 2017;23(21):3154-63.
26. Wang C, You ZL, Xia Q, Xiong T, Xia Y, Yao DZ. Upregulation of Mark3 and Rpgrip1 mRNA expression by jujuboside A in mouse hippocampus. Acta Pharmacol Sin. 2007;28(3):334-8.
27. Freeman RS, Burch RL, Crowder RJ, Lomb DJ, Schoell MC, Straub JA, et al. NGF deprivation-induced gene expression: after ten years, where do we stand? Prog Brain Re. 2004;146:111-26.
28. Brunet A, Datta SR, Greenberg ME. Transcription-dependent and-independent control of neuronal survival by the PI3K–Akt signaling pathway. Curr Opin Neurobiol. 2001;11(3):297-305.
29. Levi-Montalcini R. The nerve growth factor and the neuroscience chess board. Prog Brain Res. 2004;146:523-7.
30. Hubbard SR. Autoinhibitory mechanisms in receptor tyrosine kinases. Front Biosci. 2002;7:d330-40.
31. Patapoutian A, Reichardt LF. Trk receptors: mediators of neurotrophin action. Curr Opin Neurobiol. 2001;11(3):272-80.
32. Meloche S, Pouysségur J. The ERK1/2 mitogen-activated protein kinase pathway as a master regulator of the G1-to S-phase transition. Oncogene. 2007;26(22):3227.
33. Crowder RJ, Freeman RS. Phosphatidylinositol 3-kinase and Akt protein kinase are necessary and sufficient for the survival of nerve growth factor-dependent sympathetic neurons. J Neurosci. 1998;18(8):2933-43.
34. Lee R, Kermani P, Teng KK, Hempstead BL. Regulation of cell survival by secreted proneurotrophins. Science. 2001;294(5548):1945-8.
35. Li Q, Verma IM. NF-κB regulation in the immune system. Nat Rev Immunol. 2002;2(10):725-34.
36. Rabinovich G, Alonso C, Sotomayor C, Durand S, Bocco J, Riera C. Molecular mechanisms implicated in galectin-1-induced apoptosis: activation of the AP-1 transcription factor and downregulation of Bcl-2. Cell Death Differ. 2000;7(8):747-53.