Received 2020-08-30

Revised 2020-09-14

Accepted 2020-10-09

Introduction

Methamphetamine (MA), is an extremely addictive stimulant that adversely affects the cardiovascular and central nervous systems. Recently, the prevalence of MA use is approximately estimated at 35 million people globally [1, 2]. MA can traverse the blood-brain barrier due to its lipophilic property. It disturbs the release and reuptake of neurotransmitters, which causes ecstasy, excitement, and attentiveness [3].

Moreover, it could cross membranes independent of dopamine, norepinephrine, and serotonin transporters at high doses, leading to brain damage [4]. Previous reports in animals have shown that high doses of MA could be detrimental for dopamine neurons [5, 6].

The clinical manifestation of MA addiction includes insomnia, aggression, psychosis, and physiological signs (such as elevated blood pressure and body temperature) [7]. Further, brain studies in human abusers revealed long-lasting structural changes in white matter [8]. Additionally, a recent study disclosed a raised risk for developing Parkinson's disease in hospitalized MA abusers [9].

The dorsolateral prefrontal cortex (DLPFC) lies in the prefrontal cortex of the brain. This area plays vital role in working memory, language processing, and cognitive control of behavior [10, 11]. Moreover, it has been proposed that DLPFC precludes risky decision making (i.e., drug cravings), but this function is interrupted in substance-dependent individuals [12].

Structural imaging findings have also demonstrated a significant reduction of grey matter density in DLPFC of addicted subjects and poor executive function [13]. Accumulating evidence indicates that molecular mechanisms such as oxidative stress and apoptosis are involved in the toxic effects of MA [14]. Furthermore, a growing body of studies emphasizes autophagy, as an evolutionarily conserved mechanism for energy homeostasis, in MA-induced cell death [15].

Also, recent findings reveal the mutual interaction between the brain-derived neurotrophic factor (BDNF) and oxidative stress. For instance, in an animal study, enhanced oxidative stress led to a decrease in BDNF expression, which was reversed by vitamin E supplementation [16].

Considering experimental animal studies exhibiting MA-induced neurotoxicity, these findings' relevance needs to be evidently elucidated in human MA users. Thus, the present study was performed to assess the gene expression of generally accepted markers of autophagy and apoptosis as well as the level of BDNF protein and glutathione (GSH) content in postmortem DLPC of MA abusers.

Materials and Methods

1. Subjects and Brain Sample

A standardized protocol was employed to collect postmortem brain tissues from ten controls and ten chronic MA users in the legal medicine center of Kahrizak, Iran. The DLPC autopsy and immunohistological analysis were performed by fixing one half-brain in formaldehyde fixative. The other half associated with the DLPC was kept in an RNA stabilization solution immediately after the autopsy and frozen for real-time polymerase chain reaction (PCR).

Drug screening was also performed by collecting the blood samples of the MA users and controls. All MA users met the following selection criteria: (a) presence of MA on toxicology screens in blood and autopsied brain (b) evidence from the case records and structured interviews with the medical examiner, next of kin, and informants, of use of MA as the primary drug of abuse for at least one year prior to death; and (c) absence of neurological illness from case records or brain pathology unrelated to use of the drug.

No neurological disorders were observed in the controls, and no evidence of brain pathologies was identified in their neuropathological examinations. With no history of drug abuse, and blood tests and brain autopsy were also negative for drug use; hence, traumas and/or cardiovascular diseases were their cause of death.

2. Immunohistochemistry

Phosphate buffered saline (Sigma Aldrich, USA), containing 1% bovine serum albumin (BSA; Sigma Aldrich, USA) and 0.3% Triton X 100 (Sigma Aldrich) was employed for diluting the primary antibody in which the sections were incubated against the BDNF (1:500) overnight at 4°C using the substrate of the avidin-biotin complex (ABCAM, UK). Afterward, they were treated in 0.05M Tris-buffer (PH=7.6, Sigma Aldrich, USA) with 0.05% 3,3'-Diaminobenzidine tetrahydrochloride and 0.03% hydrogen peroxide (ABCAM, UK), counterstained and mounted after immunohistochemical reactions and ultimately observed and assessed under a light microscope (Nikon, Japan).

3. Measuring GSH Levels

The colored product of 2-Nitro-5-thiobenzoic acid (Sigma Aldrich, USA) produced by reductions in GSH caused by 5,5′-dithiobis (2-nitrobenzoic acid) (DTNB, Sigma Aldrich, USA) was quantified at 412 nm. Furthermore, the tissue lysis buffer was employed to lyse the brain tissues, and the Bradford test was conducted to evaluate protein concentrations in the specimens. A 50 μl of the DTNB solution, 0.84 ml of distilled water, and 0.1 ml of a Tris solution were added to prepare the working reagent of DTNB. After carefully mixing this solution, it underwent spectrophotometry (Eppendorf).

Also, 10 μl of the tissue lysis buffer was then added to 0.99 ml of the DTNB reagent, stirred well, and incubated at ambient temperature for five minutes. Furthermore, GSH concentrations were expressed as mmol/g of protein.

4. PCR

4.1. Extracting RNA and cDNA synthesize

High pure RNA tissue kits were employed to extract total RNA as per the manufacturer's protocol (Roche, Switzerland). The reverse transcriptase of Moloney murine leukemia virus (Fermentas, Lithuania) was then used in the presence of RNase inhibitors and random hexamers for the transcription of 1 μg of total RNA into cDNA.

4.2. Quantitative Real-Time PCR

According to Table-1, specific primers for MAP1ALC3, BECN1, CASP8, BAX, and TP53 genes were employed to perform quantitative real-time PCR considering GAPDH the internal control. Reactions were conducted by utilizing SYBR® Premix Ex Taq II (Takara, Japan) and a RotorGene™ 6000 machine (Qiagen, Germany).

Moreover, initial denaturation was carried out for 15 minutes at 95°C followed by 40 denaturation cycles at the same temperature for five seconds in primer-specific conditions and extension for 20 seconds at 60°C. The candidate groups were compared in terms of the results of quantitative PCR in REST-2009 (Qiagen, Germany).

5. Ethical Issues

This research was approved by the Research Ethics Committee associated with Shahid Beheshti University of Medical Sciences (IR.SBMU.REC.1399.104).

6. Data Analysis

The data expressed as mean±SEM and were analyzed by SPSS version 23 SPSS Inc., Chicago, IL, USA) using the independent t-test. A P<0.05 was set as the level of statistical significance.

Results

Patients Characteristics

Patients' characteristics were summarized in Table-2.

Autophagy and Apoptosis Markers Change in DLPC of MA Users

Quantitative real-time PCR for the selected autophagy and apoptosis markers showed considerable expression changes in the DLPFC of MA users (Figure-1). The up-regulation of autophagy markers BECN1 and MAP1ALC3 were detected in the DLPFC of the MA group (P<0.001).

Likewise, the expression levels of specific apoptotic genes such as CASP8, TP53, and BAX showed an increase (P<0.05).

MA Exposure Decreases GSH Content in DLPC

As shown in Figure-2, the level of GSH demonstrated a nearly 1.4-fold decrease in DLPC of the MA group compared to the control (P<0.05).

BDNF-Positive Cells Show a Reduction in MA Group

The postmortem brain sections of control and MA groups were immunohistochemically stained for BDNF (Figure-3A). According to our results, the mean number of BDNF-positive cells declined significantly in MA users compared to the control (P < 0.01, Figure-3B).

Discussion

In this study, the expression level of apoptotic and autophagic genes (BECN1, MAP1ALC3, CASP8, tP53, and BAX) were significantly elevated, while GSH content and BDNF showed substantial reductions in DLPFC of chronic MA users. Acute MA exposure provoked long-lasting damage to monoaminergic nerve terminals in the striatum, hippocampus, and prefrontal cortex, leading to a decline in dopamine release [17]. This deficit might adversely affect the executive function of DLPFC in the modulation of intentional deeds [18]. Moreover, significant reductions in dopamine transports were also reported, particularly in DLPFC, which probably explained MA-related psychiatric symptoms in MA subjects [19]. Autophagy is a mechanism of high importance to preserve cellular homeostasis. Recently, considerable attention has been paid to MA-induced autophagy. For instance, Larsen et al. [20] initially showed the formation of autophagic granules in dopaminergic neurons upon exposure to MA. This finding was also confirmed in similar studies by Fornai et al. [21] and Kanthasamy et al. [22].

Similarly, ubiquitin-positive structures were detected in the midbrain neurons of MA users, suggesting the link between autophagy and MA neurotoxicity [23]. Based on numerous research studies, MA causes neuronal apoptosis through activation of extrinsic /intrinsic death pathways mediated by up-regulation of the pro-apoptotic genes like BAX, BAK, and BAD while down-regulation of anti-apoptotic genes [24]. Besides, it is well-established that the transcription factor, P53 serves a key role in MA-induced cell death through promoting apoptotic pathways [25]. Accordingly, our gene expression data of apoptotic and autophagic genes are in good agreement with past reports [22]. BDNF, as a member of the neurotrophin family, serves important roles in neuronal differentiation and maintenance, neuroprotection, and synaptic plasticity [26]. Dysregulation of BDNF and its main receptor, TrkB, has been documented in neurodegenerative disorders such as Parkinson's disease, Alzheimer's disease, and psychiatric diseases [27]. For example, decreased BDNF production at mRNA and protein levels within the DLPFC of patients with schizophrenia was shown by Weickert et al. [28]. Likewise, decreases in BDNF transcripts were detected in the cortico-hippocampal circuit of people with schizophrenia, highlighting the disturbance of synaptic plasticity-related signaling pathways BDNF-TrkB signaling [29]. The impact of MA regarding disturbing the balance between reactive oxygen species (ROS) generation and the capacity of the antioxidant system to remove ROS has been widely investigated [30].

Excessive release of dopamine triggered by MA has been associated with increased levels of oxygen-based free radicals and dopamine quinones followed by reductions in GSH content [31, 32]. Correspondingly, upon MA treatment, augmented oxidative stress is linked with decreases in GSH peroxidase enzymatic activity in differentiated SH-SY5Y neuronal cells [33]. Exposure to MA promotes differential gene expressions leading to changes in levels of inflammatory cytokines, neurotrophins (chiefly BDNF) along with the alteration of oxidative stress-linked cascades and apoptotic events [34, 35]. One of the most important limitations of the current study was access to a sufficient number of brain samples due to the need to satisfy the families of the deceased.

Conclusion

Our study showed BDNF-positive cells as well as GSH amount, displayed significant declines in DLPFC of MA user. MA addiction provokes transduction pathways, namely apoptosis and autophagy, along with oxidative mechanisms in DLPFC. However, further investigations are needed to throw light on the cellular and molecular mechanisms that act in the various regions of the addicted brain, especially in DLPFC.

Conflict of Interest

The authors declare that they have no competing interests.

 Correspondence to: Abbas Aliaghaei, Biology and Anatomical Sciences Department, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Telephone Number: 00982123872577 Email Address: aghaei60@gmail.com

GMJ.2021;10:e2016

www.gmj.ir

Table 1. Primer Sequences for Real-Time PCR
Primers	Sequence		Annealing	Accession
GAPDH	F	GTCAGTGGTGGACCTGACCT	60ºC × 25 sec	NM_002046.6
	R	CACCACCCTGTTGCTGTAGC
BECN1	F	GGCTGAGAGACTGGATCAGG	60ºC × 25 sec	NM_003766.4
	R	CTGCGTCTGGGCATAACG
MAP1ALC3	F	GAGAAGCAGCTTCCTGTTCTGG	60ºC × 25 sec	NM_022818.4
	R	GTGTCCGTTCACCAACAGGAAG
CASP8	F	ATTAGGGACAGGAATGGAACAC	60ºC × 25 sec	NM_001228.4
	R	GGAGAGGATACAGCAGATGAAG
TP53	F	GAGGTTGGCTCTGACTGTACC	60ºC × 25 sec	NM_000546.5
	R	TCCGTCCCAGTAGATTACCAC
BAX	F	TGCCTCAGGATGCGTCCACCAA	60ºC × 25 sec	NM_138761.3
	R	CCCCAGTTGAAGTTGCCGTCAG

Table 2. Characteristics of Control and MA Users in this Study.

Case No.*	Sex	Age (years)	Postmortem interval (h)
1	M	36	6
2	M	40	7
3	M	32	11
4	M	29	13
5	M	45	8
6	M	43	5
7	M	34	7
8	M	37	15
9	M	41	19
10	M	39	5
11	M	56	4
12	M	47	9
13	M	28	7
14	M	33	5
15	M	41	11
16	M	27	7
17	M	26	19
18	M	49	21
19	M	40	18
20	M	44	8

M: Male

*Blood MA levels: 1-19 mg/ml (cases 11-20), negative (cases 1-10)

Figure 1. Quantitative real-time PCR for the selected autophagy and apoptosis genes revealed MA-related gene expression changes. The up-regulation of autophagy genes (BECN1 and MAP1ALC3), along with increases in expression levels of apoptotic genes (CASP8, TP53, and BAX). *P<0.05 and *** P<0.001 vs. control group.

Figure 2. The level of GSH showed a significant decline in DLPC of the MA group compared to the control. *P<0.05 vs. control group.

Figure 3. Immunohistochemical staining of BDNF in DLPFC of control and MA group (case No. 2 and 15, respectively). A: Arrows indicate BDNF-positive cells (original magnification 20×). B: The mean number of BDNF-positive cells decreased significantly in MA users compared to the control subjects. *P<0.01 vs. control group.

1. Rommel N, Rohleder NH, Wagenpfeil S, Härtel-Petri R, Jacob F, Wolff K-D, et al. The impact of the new scene drug “crystal meth” on oral health: a case–control study. Clin Oral Investig. 2016;20(3):469-75.
2. Kish SJ. Pharmacologic mechanisms of crystal meth. Can Med Assoc J. 2008;178(13):1679-82.
3. Volkow ND, Fowler JS, Wang G-J, Shumay E, Telang F, Thanos PK, et al. Distribution and pharmacokinetics of methamphetamine in the human body: clinical implications. PLoS One. 2010;5(12):e15269.
4. Schep LJ, Slaughter RJ, Beasley DMG. The clinical toxicology of metamfetamine. Clin Toxicol. 2010;48(7):675-94.
5. Ares-Santos S, Granado N, Espadas I, Martinez-Murillo R, Moratalla R. Methamphetamine causes degeneration of dopamine cell bodies and terminals of the nigrostriatal pathway evidenced by silver staining. Neuropsychopharmacology. 2014;39(5):1066.
6. Morrow BA, Roth RH, Redmond DE, Elsworth JD. Impact of methamphetamine on dopamine neurons in primates is dependent on age: implications for development of Parkinson's disease. Neuroscience. 2011;189:277-85.
7. Rose ME, Grant JE. Pharmacotherapy for methamphetamine dependence: a review of the pathophysiology of methamphetamine addiction and the theoretical basis and efficacy of pharmacotherapeutic interventions. Ann Clin Psychiatry. 2008;20(3):145-55.
8. Möbius C, Kustermann A, Struffert T, Kornhuber J, Müller HH. c-MRI findings after crystal meth abuse. J Addict Med. 2014;8(5):384-5.
9. Callaghan RC, Cunningham JK, Sykes J, Kish SJ. Increased risk of Parkinson's disease in individuals hospitalized with conditions related to the use of methamphetamine or other amphetamine-type drugs. Drug Alcohol Depend. 2012;120(1-3):35-40.
10. Hoshi E. Functional specialization within the dorsolateral prefrontal cortex: a review of anatomical and physiological studies of non-human primates. Neurosci Res. 2006;54(2):73-84.
11. Klaus J, Schutter DJ. The Role of Left Dorsolateral Prefrontal Cortex in Language Processing. Neuroscience. 2018;377:197-205.
12. Yamamoto DJ, Woo C-W, Wager TD, Regner MF, Tanabe J. Influence of dorsolateral prefrontal cortex and ventral striatum on risk avoidance in addiction: a mediation analysis. Drug Alcohol Depend. 2015;149:10-7.
13. Goldstein RZ, Volkow ND. Dysfunction of the prefrontal cortex in addiction: neuroimaging findings and clinical implications. Nature reviews neuroscience. 2011;12(11):652.
14. Yu S, Zhu L, Shen Q, Bai X, Di X. Recent advances in methamphetamine neurotoxicity mechanisms and its molecular pathophysiology. Behav Neurol. 2015; 2015.
15. Roohbakhsh A, Shirani K, Karimi G. Methamphetamine-induced toxicity: The role of autophagy? Chem Biol Interact. 2016;260:163-7.
16. Wu A, Ying Z, Gomez‐Pinilla F. The interplay between oxidative stress and brain‐derived neurotrophic factor modulates the outcome of a saturated fat diet on synaptic plasticity and cognition. Eur J Neurosci. 2004;19(7):1699-707.
17. Halpin LE, Collins SA, Yamamoto BK. Neurotoxicity of methamphetamine and 3, 4-methylenedioxymethamphetamine. Life Sci. 2014;97(1): 37-44.
18. Volkow N, Fowler J, Wang G, Baler R, Telang F. Imaging dopamine's role in drug abuse and addiction. Neuropharmacology. 2009;56:3-8.
19. Sekine Y, Minabe Y, Ouchi Y, Takei N, Iyo M, Nakamura K, et al. Association of dopamine transporter loss in the orbitofrontal and dorsolateral prefrontal cortices with methamphetamine-related psychiatric symptoms. Am J Psychiatry. 2003;160(9):1699-701.
20. Larsen KE, Fon EA, Hastings TG, Edwards RH, Sulzer D. Methamphetamine-induced degeneration of dopaminergic neurons involves autophagy and upregulation of dopamine synthesis. J Neurosci. 2002;22(20):8951-60.
21. Fornai F, Lenzi P, Gesi M, Soldani P, Ferrucci M, Lazzeri G, et al. Methamphetamine produces neuronal inclusions in the nigrostriatal system and in PC12 cells. J Neurochem. 2004;88(1):114-23.
22. Kanthasamy A, Anantharam V, Ali SF, Kanthasamy A. Methamphetamine induces autophagy and apoptosis in a mesencephalic dopaminergic neuronal culture model: role of cathepsin‐D in methamphetamine‐induced apoptotic cell death. Annals of the New York Academy of Sciences. 2006;1074(1):234-44.
23. Quan L, Ishikawa T, Michiue T, Li D-R, Zhao D, Oritani S, et al. Ubiquitin-immunoreactive structures in the midbrain of methamphetamine abusers. Leg Med. 2005;7(3):144-50.
24. Cadet JL, Jayanthi S, Deng X. Methamphetamine-induced neuronal apoptosis involves the activation of multiple death pathways. Review. Neurotox Res. 2005;8(3-4):199-206.
25. Asanuma M, Miyazaki I, Higashi Y, Diaz-Corrales FJ, Shimizu M, Miyoshi K, et al. Suppression of p53-activated gene, PAG608, attenuates methamphetamine-induced neurotoxicity. Neurosci Lett. 2007;414(3):263-7.
26. Kowiański P, Lietzau G, Czuba E, Waśkow M, Steliga A, Moryś J. BDNF: a key factor with multipotent impact on brain signaling and synaptic plasticity. Cell Mol Neurobiol. 2018; 38(3):579-93.
27. Bathina S, Das UN. Brain-derived neurotrophic factor and its clinical implications. Archives of medical science: AMS. 2015;11(6):1164.
28. Weickert C, Hyde T, Lipska B, Herman M, Weinberger D, Kleinman J. Reduced brain-derived neurotrophic factor in prefrontal cortex of patients with schizophrenia. Mol Psychiatry. 2003;8(6):592.
29. Reinhart V, Bove SE, Volfson D, Lewis DA, Kleiman RJ, Lanz TA. Evaluation of TrkB and BDNF transcripts in prefrontal cortex, hippocampus, and striatum from subjects with schizophrenia, bipolar disorder, and major depressive disorder. Neurobiol Dis. 2015;77:220-7.
30. Jang EY, Yang CH, Hedges DM, Kim SP, Lee JY, Ekins TG, et al. The role of reactive oxygen species in methamphetamine self‐administration and dopamine release in the nucleus accumbens. Addict Biol. 2017;22(5):1304-15.
31. Cadet JL, Krasnova IN. Molecular bases of methamphetamine-induced neurodegeneration. Int Rev Neurobiol. 2009;88:101-19.
32. Kita T, Miyazaki I, Asanuma M, Takeshima M, Wagner GC. Dopamine-induced behavioral changes and oxidative stress in methamphetamine-induced neurotoxicity. Int Rev Neurobiol. 2009;88:43-64.
33. Barayuga SM, Pang X, Andres MA, Panee J, Bellinger FP. Methamphetamine decreases levels of glutathione peroxidases 1 and 4 in SH-SY5Y neuronal cells: protective effects of selenium. Neurotoxicology. 2013;37:240-6.
34. Limanaqi F, Gambardella S, Biagioni F, Busceti CL, Fornai F. Epigenetic Effects Induced by Methamphetamine and Methamphetamine-Dependent Oxidative Stress. Oxid Med Cell Longev. 2018;2018:4982453.
35. Eskandarian Boroujeni M, Peirouvi T, Shaerzadeh F, Ahmadiani A, Abdollahifar MA, Aliaghaei A. Differential gene expression and stereological analyses of the cerebellum following methamphetamine exposure. Addict Biol. 2020 ;25(1):e12707.

References