Received 2021-08-17

Revised 2021-12-27

Accepted 2022-02-12

Introduction

Histone deacetylases (HDACs) and histone acetyltransferases (HATs) are the enzymes that modify histone acetylation and regulate chromatin structure through removing and adding the acetyl group from the lysine residues, respectively. These chromatin modifications regulate gene transcriptions and are necessary for gene expression [1]. HDACs inhibitors (HDACIs) are novel anticancer agents that induce cell death, differentiation, and cell cycle arrest. These compounds represent a broad family that includes four main structural classes compressing short-chain fatty acids
(valproic acid [VPA] and butyrate), hydroxamates (e.g., suberoylanilide hydroxamic acid [SAHA] or vorinostat, trichostatin A [TSA], LBH589 [panobinostat], oxamflatin, PXD101 [belinostat], and tubacin),
benzamides (MGCD0103 and SNDX275), and
cyclic tetrapeptides (e.g., trapoxin A, FK228 [romidepsin], and apicidin) [2]. It has been reported that HDACIs can induce apoptosis in various cancers such as breast, colon, prostate, bladder, lung, ovary, pancreas, and stomach cancer cell lines [3]. HDACIs can induce apoptosis through various mechanisms. Previously, we indicated that TSA could induce apoptosis by up-regulation of
p21Cip1/Waf1/Sdi1, p27Kip1, and p57Kip2; and down-regulation of Class I HDACs (HDACs 1, 2, and 3) and Class II HDACs (HDACs 4, 5, and 6) in LS 174T colon cancer [4]. Further, we reported that this compound could play its apoptotic effect by estrogen receptor alpha up-regulation in hepatocellular carcinoma cell lines [5].

Several studies reported that HDACIs can induce apoptosis via two well-defined intrinsic/mitochondrial (via up-regulation of several numbers of pro-apoptotic BH3-only Bcl-2 family genes) and death receptor (DR)/extrinsic (through up-regulation of DR expression) pathways [6]. In many cases, the activation of the intrinsic apoptotic pathway is the predominant apoptotic mechanism of HDACIs [6].

In addition to HDACIs, DNA methyltransferase inhibitors (DNMTIs) have been shown to be effective in reverting the promoter hypermethylation of tumor suppressor genes (TSGs) and apoptosis induction. The human genome contains four DNA methyltransferase (DNMT) genes compressing DNMT1, DNMT2, DNMT3A, and DNMT3B [7]. Broadly, DNMTIs are divided into three classes: (1) nucleoside inhibitors (e.g. 5-azacytidine [5AC], and 5-aza-20-deoxycytidine [DAC], and pyrimidin-2-one b-ribofuranoside [zebularine]); (2) nonnucleoside inhibitors (such as epigallocatechin-3-gallate [EGCG]; and (3) rationally designed inhibitors [8-10]. Recently, we reported that the effect of DNMTI 5-Aza-2'-deoxycytidine (5-Aza-CdR) on DNMT1, and CIP/KIP
family (p21, p27, and p57) genes expression, and apoptosis induction in SW480 colon cancer cell line [11]. Further, we indicated that 5-Aza-CdR decreases DNMT1, DNMT3a, and DNMT3b resulting in apoptotic induction in LCL-PI 11 hepatocellular carcinoma cell line [12] and also reactivates p15INK4, p16INK4, p18INK4, and p19INK4 genes expression in HCC PLC/PRF/5 cell line [13]. Several researchers have shown that DNMTIs induce mitochondrial-mediated apoptosis through the up-regulation of pro-apoptotic genes (such as BAX) and down-regulation of anti-apoptotic genes (e.g., Bcl-2) [14]. Finally, it has been reported that DNMTIs induce cell apoptosis and cell cycle arrest through p53-dependent and -independent pathways [15, 16]. The current study aimed to investigate the effect of sodium butyrate and EGCG on the genes of intrinsic apoptotic pathway (BAX, BAK, APAF1, Bcl-2, and Bcl-xL), p21, and p53 gene expression, cell viability, and apoptosis on PA-TU-8902, CFPAC-1, and CAPAN-1 human pancreatic cancer cell lines.

Materials and Methods

Materials

Human pancreatic cancer PA-TU-8902, CFPAC-1, and CAPAN-1 cell lines were purchased from the National Cell Bank of Pasteur Institute (Iran, Tehran). The sodium butyrate, EGCG, and Dulbecco’s modified Eagle’s medium (DMEM), total RNA extraction Kit (TRIZOL reagent), real-time polymerase chain reaction kits (qPCRMasterMix Plus for SYBR Green I dNTP), and 3-[4,5-Dimethyl-2-thiazolyl]-2,5-diphenyl-2-tetrazolium bromide (MTT) assay Kit were purchased from Sigma (St. Louis, MO, USA).

The trypsin-EDTA (Invitrogen, Cergy-Pontoise, France) and other necessary materials and kits were purchased as previously indicated [17, 18].

Ethical Considerations

This study was approved by the Ethics Committee of Jahrom University of Medical science with a code number of
IR.JUMS.REC.1399.124.

Cell Culture and Cell Viability

The PA-TU-8902, CFPAC-1, and CAPAN-1 cells were cultured in DMEM supplemented with fetal bovine serum 10% and antibiotics at 37 °C in 5% CO2 overnight, and then the cells were seeded into 96-well plates (3×105 cells per well). After 24 hours, the culture medium was replaced with a medium containing various concentrations of sodium butyrate (0, 1, 5, 10, 25, and 50 μM) and EGCG (0, 5, 10, 25, 50, and 100 μM). The control groups were exposed to an equivalent volume of solvent. After 24 hours of treatment, the treated and untreated cells were investigated by MTT assay according to standard protocols to determine cell viability as we described previously [19, 20].

Cell Apoptosis Assay

To determine cell apoptosis, the cell lines were cultured at a density of 3×105 cells/well and treated with sodium butyrate and EGCG, based on the half maximal inhibitory concentration (IC50) values and the control groups were exposed to an equivalent volume of solvents. Then, the cells were harvested by trypsin-EDTA washed with cold phosphate-buffered saline and re-suspended in a binding buffer (1x). Finally, 5 μL of Annexin V-FITC solution and 10 μL of PI solution were used according to the kit’s protocol. Then, cells were incubated for 15 minutes at room temperature in the dark and measured with a Becton Dickinson FACScan flow cytometry (Becton Dickinson, Heidelberg, Germany). Each experiment was performed in triplicate.

qRT-PCR

To determine the relative expression level of the BAX, BAK, APAF1, Bcl-2, Bcl-xL, p21, and p53 genes qRT-PCR was done. The
PA-TU-8902, CFPAC-1, and CAPAN-1 cells (at a density of 3×105 cells/well) were treated with sodium butyrate and EGCG, based on IC50 value for 24 hours, and the control groups were exposed to an equivalent volume of solvents. Then qRT-PCR was performed based on the previous studies [21, 22]. The primer sequences are shown in
Table-1 [23-30].

Statistical Analysis

Data were analyzed with a one-way analysis of variance (ANOVA) followed by Turkey test and t-test by using Graph Pad Prism Software (version 8.0, GraphPad Software Inc.,
La Jolla, CA, USA). P<0.05 was considered to indicate a significant difference.

Results

Cell Viability

As shown in Figure-1, EGCG (A-C) and sodium butyrate (D-F) induced significant cell growth inhibition (P<0.001). Among treated cell lines with sodium butyrate, the CAPAN-1 has the lowest IC50
(10.56 μM, Table-2). Also, the lowest IC50 for the EGCG-treated cells was related to PA-TU-8902 (9.979 μM). Other details of IC50 are presented in Table-2.

Cell Apoptosis

As indicated in Figure-2, sodium butyrate induced cell apoptosis in the all cell lines. The maximal apoptosis (94.87%) was seen in the PA-TU-8902 cell line (Figure-2D, P<0.001). Also, EGCG leads to apoptosis in the all the cell lines (Figure-3). In comparison to sodium butyrate, EGCG induced lower apoptosis in the PA-TU-8902 (Figure-4).

Genes Expression Levels in Sodium Butyrate-Treated Cell Lines

Sodium butyrate up-regulated the BAX, BAK, APAF1, p21, and p53 and down-regulated Bcl-2 and Bcl-xL after 24 hours of treatment in all three cell lines (Figure-5A-C).

Genes Expression Levels in EGCG-Treated Cell Lines

The result showed that EGCG significantly up-regulated the BAX, BAK, APAF1, p21, and p53 and down-regulated Bcl-2 and Bcl-xL after treatment in the PA-TU-8902 cell line (Figure-5D). Also, up-regulation of the BAX, BAK, and APAF1 as well as down-regulation of Bcl-2 and Bcl-xL were observed in the CFPAC-1 cell line (Figure-5E). Regarding Figure-5, treatment with EGCG leads to significant up-regulation of BAX, BAK, APAF1, p21, and p53 in the CAPAN-1 cell line (F); however, there were no significant changes in Bcl-2 and Bcl-xL expression level.

Discussion

Cancer, a complex epigenetic disease resulting from mutation of TSGs, can be developed due to alteration of signaling pathways; it has been well known to have numerous links to apoptosis. Many of the genes that control the processes of apoptosis have been identified [31]. Two molecular pathways exist to induce apoptosis, the intrinsic (mitochondrial) and the extrinsic (DR) pathways. The intrinsic pathway leads to apoptosis under the control of mitochondrial pro-enzymes [31]. The extrinsic pathway is triggered by the Fas plasma membrane DR binding to its extracellular ligand. In both cases, outer mitochondrial membranes become permeable to internal cytochrome c, which is then released into the cytosol [32]. Cytochrome c recruits pro-caspase-9 and APAF1 to compose the apoptosome, culminating in apoptosis [31]. HDACIs and DNMTIs can induce apoptosis via the DR pathway [32, 33]. In the present study, we indicated that sodium butyrate and EGCG could induce cell apoptosis through the extrinsic pathway in human pancreatic cancer cell lines. These compounds up-regulated BAX, BAK, APAF1, p21, and p53 expression and down-regulated Bcl-2 and Bcl-xL expression, resulting in apoptosis induction. Similarly, it has been reported that sodium butyrate can induce apoptosis in pancreatic cancer ASPC-1 and PANC-1 cell lines via the mitochondrial apoptotic pathway, Bcl-2 and Bcl-xL down-regulation, depolarization of the mitochondrial membrane, cytochrome c release from mitochondria, activation of caspases (caspase-9 and -3) and apoptosis induction [34]. A similar effect has been shown in the HT-29 human colon cancer cell line [35]. In human COLO 205 colon adenocarcinoma cells, sodium butyrate can induce apoptosis by up-regulation of the BAK and reduction of anti-apoptotic
BCL-xL, XIAP, and survivin proteins [36]. It has been demonstrated that sodium butyrate increases the expression levels of p21 and p53, the release of cytochrome c, and alters the balance of anti- and pro-apoptotic Bcl-2 family proteins in HCT 116 human colorectal cancer cell line [37]. Additionally, in vitro studies have demonstrated that EGCG, as DNMTIs, induces cell growth inhibition and apoptosis induction by the up-regulation of Fas and Bax, and down-regulation of Bcl-2 leads to the activation of caspase-3, -7, -8, and -9 in B lymphoma [38]. In human laryngeal epidermoid carcinoma of the larynx (Hep2 cell line), it has been indicated that EGCG treatment increases the levels of BAX and p53 with a corresponding decrease in Bcl-2 level [39]. Besides, significant up-regulation of BAX, p21, p27, and p53, as well as down-regulation of c-myc and Bcl-2 due to EGCG treatment has been shown in Sarcoma180 cells [40]. Recent in vitro studies have indicated that HDACIs and DNMTIs can induce apoptosis in a
p53-dependent and -independent manner
[41-43]. Inconsistent with the mentioned reports, we indicated that sodium butyrate and EGCG can induce apoptosis in human pancreatic cancer cell lines via a p53-dependent and -independent manner. EGCG treatment could not induce significant p53 up-regulation in the CFPAC-1 cell line. Further, minimal cell apoptosis was observed in this group. It could be concluded that a
p53-dependent manner can induce more strong apoptosis. However, we do not evaluate protein levels; hence, it is recommended that future studies consider this issue.

Conclusion

We indicated that sodium butyrate and EGCG could induce apoptosis in human pancreatic cancer cell lines (PA-TU-8902, CFPAC-1, and CAPAN-1) through the intrinsic apoptotic pathway in a p53-dependent and -independent manner.

Acknowledgments

This study was supported by the adjutancy of research of Jahrom University of Medical Sciences, Iran. Also, this work was a part of Iraj Poursadgh Soufiani’s thesis
(code number: IR.JUMS.REC.1399.124).

Conflict of Interest

The authors report no conflict of interest.

 Correspondence to: Fraidoon Kavoosi, Research Center for Non-Communicable Diseases, Jahrom University of Medical Sciences, Jahrom, Iran Telephone Number: +987154265814 Email Address: kavoosifraidoon@gmail.com

Table 1. The Primer Sequences of Studied Genes.

Primer	Primer sequences (5' to 3')	Length (bp)	Reference
BAX	F: AGTAACATGGAGCTGCAGAGGAT R: GCTGCCACTCGGAAAAAGAC	77	23
BAK	F: CCTGCCCTCTGCTTCTGA R: CTGCTGATGGCGGTAAAAA	82	24
APAF1	F: TGCGCTGCTCTGCCTTCT R: CCATGGGTAGCAGCTCCTTCT	142	25
Bcl-2	F: TGGCCAGGGTCAGAGTTAAA R: TGGCCTCTCTTGCGGAGTA	147	26
Bcl-xL	F: TCCTTGTCTACGCTTTCCACG R: GGTCGCATTGTGGCCTTT	62	27
p21	F: CTGGAGACTCTCAGGGTCGAA R: GGATTAGGGCTTCCTCTTGGA	197	28
p53	F: ATGTTTTGCCAACTGGCCAAG R: TGAGCAGCGCTCATGGTG	153	29
GAPDH	F: TGTTGCCATCAATGACCCCTT R: CTCCACGACGTACTCAGCG	148	30

Figure 1. Effects of various concentration of EGCG (0, 5, 10, 25, 50, and 100 μM) on cell viability of
PA-TU-8902 (A), CFPAC-1 (B), and CAPAN-1 (C) cell lines. Also, cell viability of sodium butyrate (0, 1, 5, 10, 25, and 50 μM) was determined by MTT assay at 24 hours on PA-TU-8902 (D), CFPAC-1 (E), and CAPAN-1 (F) cell lines. Both compounds significantly inhibited the growth of all three cell lines in a dose-dependent manner. **P<0.005 and ****P<0.0001 vs. control

Table 2. Half Maximal Inhibitory Concentration Values of Sodium Butyrate and Epigallocatechin-3-Gallate.

Cell lines	Treatment	IC50 (μM)	R squared
PA-TU-8902	EGCG	12.57	0.9855
	Sodium butyrate	9.979	0.9735
CFPAC-1	EGCG	13.49	0.9807
	Sodium butyrate	11.09	0.9486
CAPAN-1	EGCG	10.56	0.9895
	Sodium butyrate	11.61	0.9466

IC50: Half maximal inhibitory concentration; EGCG: Epigallocatechin-3-gallate; µM: Micromole; R-Squared: R² or the coefficient of determination

Figure 2. The apoptotic effect of sodium butyrate on control group (A) versus CFPAC-1 (B), CAPAN-1 (C), and PA-TU-8902 (D) cells at 24 hours. Maximal apoptosis was seen in the PA-TU-8902 cell line.

Figure 3. The apoptotic effect of EGCG on control group (A) versus CFPAC-1 (B), CAPAN-1 (C), and PA-TU-8902 (D) cells at 24 hours. Maximal apoptosis was observed in the PA-TU-8902 cell line.

Figure 4. The apoptotic effects of EGCG compared with sodium butyrate on PA-TU-8902, CFPAC-1, and CAPAN-1cells. The sodium butyrate had a more significant apoptotic effect than EGCG. *P<0.0001 vs. control

Figure 5. The relative expression level of BAX, BAK, APAF1, Bcl-2, Bcl-xL, p21, and p53 gene in the PA-TU-8902 (A), CFPAC-1 (B), and CAPAN-1(C) cell lines treated with sodium butyrate versus untreated control groups at 24 hours. Also, the effects of EGCG on the mentioned genes expression levels for PA-TU-8902 (D), CFPAC-1 (E), and CAPAN-1 (F) cell lines are presented. *P<0.05, **P<0.005, and ***P<0.0001 vs. control

References

1. Bolden JE, Peart MJ, Johnstone RW. Anticancer activities of histone deacetylase inhibitors. Nat Rev Drug Discov. 2006;5(9):769-84.
2. Walkinshaw DR, Yang XJ. Histone deacetylase inhibitors as novel anticancer therapeutics. Curr Oncol. 2008;15(5):237-43.
3. Rosato RR, Grant S. Histone deacetylase inhibitors in cancer therapy. Cancer biology & therapy. 2003;2(1):31-8.
4. Sanaei M, Kavoosi F. Effect of Zebularine in Comparison to and in Combination with Trichostatin A on CIP/KIP Family (p21Cip1/Waf1/Sdi1, p27Kip1, and p57Kip2), DNMTs (DNMT1, DNMT3a, and DNMT3b), Class I HDACs (HDACs 1, 2, 3) and Class II HDACs (HDACs 4, 5, 6) Gene Expression, Cell Growth Inhibition and Apoptosis Induction in Colon Cancer LS 174T Cell Line. Asian Pac J Cancer Prev. 2020;21(7):2131-9.
5. Sanaei M, Kavoosi F, Arabloo M. Effect of Curcumin in Comparison With Trichostatin A on the Reactivation of Estrogen Receptor Alpha Gene Expression, Cell Growth Inhibition and Apoptosis Induction in Hepatocellular Carcinoma Hepa 1-6 Cell lLine. Asian Pac J Cancer Prev. 2020;21(4):1045-50.
6. Matthews GM, Newbold A, Johnstone RW. Intrinsic and extrinsic apoptotic pathway signaling as determinants of histone deacetylase inhibitor antitumor activity. Adv Cancer Res. 2012;116:165-97.
7. Stresemann C, Brueckner B, Musch T, Stopper H, Lyko F. Functional diversity of DNA methyltransferase inhibitors in human cancer cell lines. Cancer Res. 2006;66(5):2794-800.
8. Issa JP. DNA methylation as a therapeutic target in cancer. Clin Cancer Res. 2007;13(6):1634-7.
9. Flotho C, Claus R, Batz C, Schneider M, Sandrock I, Ihde S, et al. The DNA methyltransferase inhibitors azacitidine, decitabine and zebularine exert differential effects on cancer gene expression in acute myeloid leukemia cells. Leukemia. 2009;23(6):1019-28.
10. Lyko F, Brown R. DNA methyltransferase inhibitors and the development of epigenetic cancer therapies. J Natl Cancer Inst. 2005;97(20):1498-506.
11. Sanaei M, Kavoosi F. Effect of 5-Aza-2'-Deoxycytidine in Comparison to Valproic Acid and Trichostatin A on Histone Deacetylase 1, DNA Methyltransferase 1, and CIP/KIP Family (p21, p27, and p57) Genes Expression, Cell Growth Inhibition, and Apoptosis Induction in Colon Cancer SW480 Cell Line. Adv Biomed Res. 2019;8:52.
12. Sanaei M, Kavoosi F, Esmi Z. The Effect of 5-Aza-2'-Deoxycytidine in Combination to and in Comparison with Vorinostat on DNA Methyltransferases, Histone Deacetylase 1, Glutathione S-Transferase 1 and Suppressor of Cytokine Signaling 1 Genes Expression, Cell Growth Inhibition and Apoptotic Induction in Hepatocellular LCL-PI 11 Cell Line. Int J Hematol Oncol Stem Cell Res. 2020;14(1):45-55.
13. Sanaei M, Kavoosi F, Ghasemi A. Investigation of the Effect of 5-Aza-2'-Deoxycytidine on p15INK4, p16INK4, p18INK4, and p19INK4 Genes Expression, Cell Growth Inhibition, and Apoptosis Induction in Hepatocellular Carcinoma PLC/PRF/5 Cell Line. Adv Biomed Res. 2020;9:33.
14. Tan W, Zhou W, Yu HG, Luo HS, Shen L. The DNA methyltransferase inhibitor zebularine induces mitochondria-mediated apoptosis in gastric cancer cells in vitro and in vivo. Biochem Biophys Res Commun. 2013;430(1):250-5.
15. Shin DY, Sung Kang H, Kim GY, Kim WJ, Yoo YH, Choi YH. Decitabine, a DNA methyltransferases inhibitor, induces cell cycle arrest at G2/M phase through p53-independent pathway in human cancer cells. Biomed Pharmacother. 2013;67(4):305-11.
16. Yang PM, Lin YT, Shun CT, Lin SH, Wei TT, Chuang SH, Wu MS, Chen CC. Zebularine inhibits tumorigenesis and stemness of colorectal cancer via p53-dependent endoplasmic reticulum stress. Sci Rep. 2013;3:3219.
17. Sanaei M, Kavoosi F, Roustazadeh A, Shahsavani H. In Vitro Effect of the Histone Deacetylase Inhibitor Valproic Acid on Viability and Apoptosis of the PLC/PRF5 Human Hepatocellular Carcinoma Cell Line. Asian Pac J Cancer Prev. 2018;19(9):2507-10.
18. Sanaei M, Kavoosi F. Effect of curcumin and trichostatin a on the expression of DNA methyltransfrase 1 in hepatocellular carcinoma cell line hepa 1-6. Iran J Ped Hematol Oncol. 2018;8(4):193-201.
19. Sanaei M, Kavoosi F *, Behjoo H. Effect of valproic acid and zebularine on SOCS-1 and SOCS-3 gene expression in colon carcinoma SW48 cell line. Exp Oncol. 2020;42(3):183-7.
20. Sanaei M, Kavoosi F, Mohammadi M, Khanezad M. Effect of 5-aza-2′-deoxycytidine on p16INK4a, p14ARF, p15INK4b Genes Expression, Cell Viability, and Apoptosis in PLC/PRF5 and MIA Paca-2 Cell Lines. Iran J Ped Hematol Oncol. 2019;9(4):219-28.
21. Sanaei M, Kavoosi F, Salehi H. Genistein and Trichostatin A Induction of Estrogen Receptor Alpha Gene Expression, Apoptosis and Cell Growth Inhibition in Hepatocellular Carcinoma HepG 2 Cells. Asian Pac J Cancer Prev. 2017;18(12):3445-50.
22. Sanaei M, Kavoosi F, Pourahmadi M, Moosavi SN. Effect of Genistein and 17-β Estradiol on the Viability and Apoptosis of Human Hepatocellular Carcinoma HepG2 cell line. Adv Biomed Res. 2017;6:163.
23. Cao XX, Mohuiddin I, Chada S, Mhashilkar AM, Ozvaran MK, McConkey DJ, Miller SD, Daniel JC, Smythe WR. Adenoviral transfer of mda-7 leads to BAX up-regulation and apoptosis in mesothelioma cells, and is abrogated by over-expression of BCL-XL. Mol Med. 2002;8(12):869-76.
24. Ierano C, Chakraborty AR, Nicolae A, Bahr JC, Zhan Z, Pittaluga S, Bates SE, Robey RW. Loss of the proteins Bak and Bax prevents apoptosis mediated by histone deacetylase inhibitors. Cell Cycle. 2013;12(17):2829-38.
25. Ashur-Fabian O, Adamsky K, Trakhtenbrot L, Cohen Y, Raanani P, Hardan I, et al. Apaf1 in chronic myelogenous leukemia (CML) progression: reduced Apaf1 expression is correlated with a H179R p53 mutation during clinical blast crisis. Cell Cycle. 2007;6(5):589-94.
26. Xu Y, Liu L, Qiu X, Liu Z, Li H, Li Z, Luo W, Wang E. CCL21/CCR7 prevents apoptosis via the ERK pathway in human non-small cell lung cancer cells. PLoS One 2012;7(3) ):e33262.
27. Zhang YL, Pang LQ, Wu Y, Wang XY, Wang CQ, Fan Y. Significance of Bcl-xL in human colon carcinoma. World J Gastroenterol. 2008;14(19):3069-73.
28. Chen YX, Fang JY, Zhu HY, Lu R, Cheng ZH, Qiu DK. Histone acetylation regulates p21WAF1 expression in human colon cancer cell lines. World J Gastroenterol. 2004;10(18):2643-6.
29. Mitupatum T, Aree K, Kittisenachai S, Roytrakul S, Puthong S, Kangsadalampai S, Rojpibulstit P. mRNA Expression of Bax, Bcl-2, p53, Cathepsin B, Caspase-3 and Caspase-9 in the HepG2 Cell Line Following Induction by a Novel Monoclonal Ab Hep88 mAb: Cross-Talk for Paraptosis and Apoptosis. Asian Pac J Cancer Prev. 2016;17(2):703-12.
30. Wu S, Ge Y, Huang L, Liu H, Xue Y, Zhao Y. BRG1, the ATPase subunit of SWI/SNF chromatin remodeling complex, interacts with HDAC2 to modulate telomerase expression in human cancer cells. Cell Cycle. 2014;13(18):2869-78.
31. Ouyang L, Shi Z, Zhao S, Wang FT, Zhou TT, Liu B, et al. Programmed cell death pathways in cancer: a review of apoptosis, autophagy and programmed necrosis. Cell Prolif. 2012;45(6):487-98.
32. Inoue S, Riley J, Gant TW, Dyer MJ, Cohen GM. Apoptosis induced by histone deacetylase inhibitors in leukemic cells is mediated by Bim and Noxa. Leukemia. 2007;21(8):1773-82.
33. Tsao T, Shi Y, Kornblau S, Lu H, Konoplev S, Antony A, et al. Concomitant inhibition of DNA methyltransferase and BCL-2 protein function synergistically induce mitochondrial apoptosis in acute myelogenous leukemia cells. Ann Hematol. 2012;91(12):1861-70.
34. Natoni F, Diolordi L, Santoni C, Gilardini Montani MS. Sodium butyrate sensitises human pancreatic cancer cells to both the intrinsic and the extrinsic apoptotic pathways. Biochim Biophys Acta. 2005;1745(3):318-29.
35. Wang L, Luo HS, Xia H. Sodium butyrate induces human colon carcinoma HT-29 cell apoptosis through a mitochondrial pathway. J Int Med Res. 2009;37(3):803-11.
36. Pajak B, Gajkowska B, Orzechowski A. Sodium butyrate sensitizes human colon adenocarcinoma COLO 205 cells to both intrinsic and TNF-alpha-dependent extrinsic apoptosis. Apoptosis. 2009;14(2):203-17.
37. Wei ZL, Zhao QL, Yu DY, Hassan MA, Nomura T, Kondo T. Enhancement of sodium butyrate-induced cell death and apoptosis by X-irradiation in the human colorectal cancer cell line HCT 116. Oncol Rep. 2008;20(2):397-403.
38. Wang J, Xie Ya, Feng Y, Zhang L, Huang X, Shen X, et al. (-)-Epigallocatechingallate induces apoptosis in B lymphoma cells via caspase-dependent pathway and Bcl-2 family protein modulation. Int J Oncol. 2015;46(4):1507-15.
39. Lee J-H, Jeong Y-J, Lee S-W, Kim D, Oh S-J, Lim H-S, et al. EGCG induces apoptosis in human laryngeal epidermoid carcinoma Hep2 cells via mitochondria with the release of apoptosis-inducing factor and endonuclease G. Cancer lett. 2010;290(1):68-75.
40. Manna S, Banerjee S, Mukherjee S, Das S, Panda CK. Epigallocatechin gallate induced apoptosis in Sarcoma180 cells in vivo: mediated by p53 pathway and inhibition in U1B, U4-U6 UsnRNAs expression. Apoptosis. 2006;11(12):2267.
41. Sonnemann J, Marx C, Becker S, Wittig S, Palani C, Krämer O, et al. p53-dependent and p53-independent anticancer effects of different histone deacetylase inhibitors. Br J Cancer. 2014;110(3):656-67.
42. Schneider-Stock R, Diab-Assef M, Rohrbeck A, Foltzer-Jourdainne C, Boltze C, Hartig R, et al. RETRACTION: 5-aza-Cytidine is a potent inhibitor of DNA methyltransferase 3a and induces apoptosis in HCT-116 colon cancer cells via Gadd45-and p53-dependent mechanisms. J Pharmacol Exp Ther. 2005;312(2):525-36.
43. Shin DY, Kang HS, Kim G-Y, Kim W-J, Yoo YH, Choi YH. Decitabine, a DNA methyltransferases inhibitor, induces cell cycle arrest at G2/M phase through p53-independent pathway in human cancer cells. Biomed Pharmacother. 2013;67(4):305-11.