Received 2021-09-28

Revised 2021-10-29

Accepted 2021-11-01

Introduction

Acute myeloid leukemia (AML), as the most common type of acute leukemia, is an increased proliferation of precursor cells and acclamation of immature blast cells, which can result in the arrest of maturation.

The cure rate of AML is dependent on age, which is about 35% in younger than 60 years, and it is about 15% in those older than 60 years [1].

However, more than half of cured patients relapse after AML therapeutics, which may be due to the presence of minimal residual disease [2].

This residual presence may be due to chemotherapy. High-dose chemotherapy as a treatment for AML patients rapidly targeting dividing cells can lead to the acclamation of maturated proteins, poor efficacy, and high toxicity of this treatment option [3].

In recent studies, novel treatment strategies have been suggested based on small molecules and mediators involved in signal transduction pathways and cell cycle regulation in the prognosis of AML [4, 5].

In this regard, studies are underway to find non-invasive biomarkers that could be used for diagnosis, classification, and treatment progression [6]. Also, these potential markers were initial steps for the investigation of new targeted drug development [7, 8].

CX3CL1 (fractalkine) can act as an adhesion or chemical molecule for T-cells and natural killer cells. Except for CX3CL1 and CXCL12, which are mainly expressed by neurons and astrocytes, most chemokines are not inherently expressed but can be simulated under various conditions of diseases [9]. CX3CL1 expression has been reported in many types of hematopoietic and/or non-hematopoietic cells, such as endothelial and epithelial cells, lymphocytes, neurons, microglial cells, and osteoblasts. CX3CL1 is involved in applying leukocytes associated with multiple inflammatory disorders and in the tumorigenic process and anti-tumor properties [10].

The role of CX3CL1/CX3CR1 in the pathogenesis of cancer has long been discussed. The dual activity of CX3CL1 as a chemoattractant for leukocytes and the adhesion molecule for tumor cells that express the receptor may provide various results regarding the tumorigenesis process [11]. The CX3CL1/CX3CR1 axis is involved in B-cell chronic lymphocytic leukemia expression in the interaction between leukemia cells and the tumor microenvironment [12].

Interleukins (ILs) play an important role in the body's natural immune response and enhance the ability of the immune system to inhibit cancer. IL-6 is involved in both innate and acquired immunity [13].

The active form of IL-6 is a homodimer with each subunit being a spherical domain with four alpha-helices.

The IL-6 receptor comprises a cytokine-binding subunit and a signal transduction subunit, which belong to the type I cytokine receptor family. AML often produces IL-6 and other cytokines such as colonic stimulating factor (CSF; G-CSF, M-CSF, and GM-CSF), tumor necrosis factor (TNF)-α, and IL-1. AML blast cells that produce only IL-6 could not be independent of in vitro colonies, whereas blast cells that express CSF in addition to IL-6 were able to form such colonies [13, 14].

IL-6 can modify gene transcription through Janus kinase (JAK) and signal transducers and transcriptional activators (STAT) and could inhibit apoptosis in different types of tumor cells.

Also, IL-6 has been known as an inflammatory mediator involved in the biology of carcinoma and can serve as both mitogen and survival factors [15].

The aim of this study was to investigate the expression changes of CX3CL1 and IL-6 genes as two important factors during remission induction therapy as a possible prognostic factor in AML patients.

Materials and Methods

In this study, 69 patients diagnosed with AML were selected from the hematology-oncology ward of Namazi hospital affiliated to Shiraz University of Medical Sciences (SUMS) as a tertiary medical health center using the census selection method. Diagnosis of AML was considered based on the World Health Organization (WHO) system.

All the procedures were approved by the Ethics Committee of SUMS (code: IR.SUMS.REC.1394-01-01-11234). All subjects signed an informed contest at the beginning of the study. Bone marrow sample was evaluated in the case of morphology and cytochemistry, and classified according to the French–American–British (FAB) classification system. Also, 5 ml of venous blood was sampled for evaluating complete blood count, blast percentage, and hemoglobin (HB) levels. All patients received standard chemotherapy, which consisted of daunorubicin and cytarabine, as well as, for AML-M3 patients, arsenic trioxide and all-trans-retinoic acid (ATRA) in two divided doses in addition to standard remission induction chemotherapy strategy as previously described [16-20].

RNA Isolation and cDNA Synthesiss

Before and after chemotherapy, 5 ml of venous blood was sampled and was collected in ethylenediaminetetraacetic acid (EDTA).

The peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll-Hypaque density gradient centrifugation. Total RNA was isolated by Trizol (Invitrogen, Carlsbad, CA, USA) using the RNX-Plus solution (CinnaGen, Tehran, Iran) according to the protocol supplied by the manufacturer as previously described [16-18, 21].

Real-Time Polymerase Chain Reaction (RT-PCR)

The relative mRNA expression of CX3CL1 and IL-6 genes were evaluated by the SYBR Premix Ex Taq II (Tli RNaseH Plus) Master Mix (Takara, Japan). Internal control for minor fluctuations was the glyceraldehyde 3-phosphate dehydrogenase gene, and the expressions of CX3CL1 and IL-6 mRNAs were normalized. The RT-PCR method was performed using SYBR Premix Ex TaqTM II (Tli RNaseH Plus, Takara, Japan) and designed specific primers for each gene in an iQ5 thermocycler (BioRad Laboratories, USA) according to the manufacturer’s instructions, as previously described [16-18].

Primer sequences are presented in Table-1.

Statistical Analysis

The differences in the mean expression levels of CX3CL1 and IL-6 before and after chemotherapy were compared using the paired t-test. To determine significant differences in gene expression levels among patients with a different type of AML (FAB subtypes), we used the one-way ANOVA. Furthermore, a Chi-square test was used to analyze the mean expression levels of CX3CL1 and IL-6 and other laboratory data. The results were analyzed by using SPSS software version 15 (IBM Corp., Armonk, NY, USA). The P-value less than 0.05 was considered significant.

Results

Thirty-six men and 33 women with a mean age of more than 40 years old were evaluated. AML-M2 was the most frequent (43.5%) subgroup among AML patients. More descriptive variables are presented in Table-2. AML patients present with increased white blood cell (WBC) count (called leukocytosis); however, the platelet (PLT) count and HB were critically low. Before chemotherapy, the expression of the CX3CL1 was markedly different between both genders (P=0.007), while expression of the IL-6 was not significant (P=0.161). Also, before chemotherapy, there was no significant correlation between the expression of CX3CL1 and IL-6 with age, PLT, and HB levels of AML patients (P>0.05).

It was the same with IL-6 expression and WBC count. While, there was a significant correlation between CX3CL1 expression and WBC count (r=-0.261, P=0.03). Also, the expression of CX3CL1 and IL-6 before chemotherapy showed no differences among AML subgroups (P=0.068 and P=0.101, respectively, Table-2). The ΔCt mean of CX3CL1 and IL-6 expressions was 6.48±4.68 and 4.62±5.43, respectively. The ΔCt mean of CX3CL1 had a significant difference according to gender (P=0.013), whereas in the case of IL-6 expression, there was no significant difference based on gender (P=0.065).

Concerning remission of patients, the ΔCt mean of CX3CL1 and IL-6 mRNA revealed a significant difference in patients with complete remission compared to patients without complete remission (P>0.05). The ΔCt mean of CX3CL1 and IL-6 mRNAs had no significant difference among AML subtype groups (P=0.51 and P=0.11, respectively).

There was an inverse correlation between the CX3CL1 expression and age (r=-0.262, P=0.03). Also, regarding laboratory data before chemotherapy, WBC positively correlated with CX3CL1 expression. However, there was no significant correlation between IL-6 expression and age and laboratory data (Table-3). The expression rate of CX3CL1 and IL-6 were significantly increased after chemotherapy (P<0.0001, Figure-1 and Table-4).

Discussion

In this study, the expression changes of CX3CL1 and IL-6 were investigated during remission induction therapy in patients with AML to find out the effect of expression changes of these genes on the prognosis of AML. Based on our data, CX3CL1 and IL-6 expression were increased after chemotherapy. Also, our data showed that the CX3CL1 expression at the baseline was related to WBC count, and it had a significant difference between gender.

Also, there was a negative correlation between the ΔCt mean of CX3CL1 and the age of patients. On the other hand, the ΔCt mean of CX3CL1 had a considerable difference between both genders, while this difference was not observed in the ΔCt mean of IL-6.

As the regulators of the immune system, cytokines play a role in immune response and inflammation. Therefore, they are effective in transplant success [22]. The CX3CL1 and IL-6 play an important role in regulating the expression of pro- and anti-inflammatory cytokines [9, 13]. Allogeneic hematopoietic cell transplantation is a curative treatment of AML, especially for young patients, but this method is complicated by the occurrence of graft-versus-host disease (GVHD) [23, 24].

Brissot et al. reported that the CX3CL1 pathway participates in acute GVHD pathogenesis [25]. Furthermore, Li et al. showed that the low level of IL-6 was related to treatment failure of AML [26]. Devemy et al. demonstrated that changes of the leukemia cells during the remission phase were associated with an increased level of IL-6 [27].

Erreni et al. showed that glioblastoma cancer stem cells and precursor cells express CX3CL1 and CX3CR1, which can occur early in the tumorigenesis process [28]. In other studies, expression of the CX3CL1 in neuroblastoma cell lines elicited an effective anti-neuroblastoma immune response through natural killer cells and T-cells [29]. Zeng et al. studied the expression of IL-6 and its receptor in 39 patients AML, 23 patients with acute lymphoblastic leukemia (ALL), and seven patients with acute mixed lineage leukemia (AMLL). They showed high levels of IL-6 were expressed in 21% of AML patients and 29% of AMLL patients, whereas in ALL, the expression of IL-6 was almost negligible [29]. Also, Sugiyama et al. reported similar results. They reported that the expression of IL-6 and its associated genes in acute leukemia was common in AML but rare in ALL [13]. However, the roles of IL-6 and CXCL3 in the development and prognosis of AML are unclear. So, it seems the CX3L1 and IL-6 have important roles in response to the treatment of AML.

Conclusion

Based on the results of our study, increased expression of CX3CL1 and IL-6 after induction chemotherapy might indicate a possible role of these two chemokines in AML. So, CX3L1 and IL-6 can be used as markers to repose the induction chemotherapy. Further large-scale studies are needed to confirm the specific role of CX3CL1 and IL-6 in the prognosis of AML.

Acknowledgment

The authors thank the patients that participated in this study and the staff of the hematology-oncology ward of Namazi hospital. Also, this article was supported by a grant (number: 94-01-01-11234) awarded to Dr. Vakil from SUMS, Shiraz, Iran.

Conflict of Interest

One of the authors of the article (A. Karimi) is the "editor in chief" of the journal. Based on the journal policy, this author was completely excluded from any review process of this article and the review process of this article. Other authors declare that there are no conflicts of interest.

 Correspondence to: Mohammad Kazem Vakil, Assistant Professor of hematology and oncology department of Non-Communicable Diseases Research Center, Fasa University of Medical Sciences, Fasa, Iran Telephone Number: 09171079396 Email Address: mvakil31@yahoo.com

GMJ.2021;10:e2288

www.gmj.ir

Table 1. Primer Sequence for RT-PCR

Gene	Primer sequences (5'->3')
IL-6	Forward: AGAGGCACTGGCAGAAAACA
	Reverse: CAGCTCTGGCTTGTTCCTCA
CX3CL-1	Forward: CCACTCCCTGCAACCTGATT
	Reverse: ACACCACACTAGCCTCATGC
GAPDH	Forward: GGACTCATGACCACAGTCCA
	Reverse: CCAGTAGAGGCAGGGATGAT

Table 2. Clinical and Laboratory Variable of AML Patients Before Induction Chemotherapy

Variable	n (%) or Mean±SD
Sex
Male	36 (52.2)
Female	33 (47.8)
Age (year)	47.42±16.54
FAB classification
M0	11 (15.9)
M2	30 (43.5)
M3	7 (10.1)
M4	10 (14.5)
M5	8 (11.6)
M6	2 (2.9)
M7	0 (0)
Blood count
WBC (10^3/µL)	42175.54±65163.05
HB (g/dl)	8.08±2.27
PLT (10^3/µL)	56168.59 ± 64373.26
LDH (U/L)	1307.88 ± 994.78
Response rate after treatment
CR	34 (49.3)
NCR	35 (50.7)

FAB: French-American-British; WBC: White blood cell; HB: Hemoglobin; PLT: Platelets; LDH: Lactate dehydrogenase; CR: Complete remission; NCR: Not complete remission.

Table 3. Change in CX3CL1 and IL-6 Expression According to Clinical and Other Laboratory Variable of Patients

Variable	CX3CL1		IL-6
	Mean ± SD	P-value	Mean ± SD	P-value
Sex
Male	28±2.59	0.007	26.31±3.73	0.168
Female	29.43±1.58		27.38±2.43
Age (year)	-0.178*	0.142	0.101*	0.407
FAB classification
M0	28.13±0.82	0.068	26.57±2.32	0.101
M2	29.27±1.95		27.36±2.78
M3	28.48±2.63		24.44±2.61
M4	28.19±3.34		26.89±4.19
M5	28.87±1.87		27.94±2.97
M6	24.48±3.34		22.66±7.58
M7	------		-----
Blood count
WBC (10^3/µL)	-0.261*	0.03	-.096*	0.433
HB (g/dl)	0.163*	0.18	0.011*	0.93
PLT (10^3/µL)	0.219*	0.07	0.059*	0.632
LDH (U/L)	-0.2*	0.327	-0.294*	0.145
Response rate after treatment
CR	28.71±2.6	0.932	27.12±3.63	0.459
NCR	28.64±1.94		26.5±2.74

* Pearson correlation

FAB: French-American-British; WBC: White blood cell; HB: Hemoglobin; PLT: Platelets; LDH: Lactate dehydrogenase; CR: Complete remission; NCR: Not complete remission.

Figure 1. Expression change in CX3CL1 and IL-6 following chemotherapy in AML patients.

**** P<0.0001.

Table 4. Change in the ΔCt Mean of CX3CL1 and IL-6 Expression According to Clinical and Laboratory Variable of Patients

Variable	ΔCt CX3CL1		ΔCt IL-6
	Mean ± SD	P-value	Mean ± SD	P-value
Sex
Male	5.16±4.73	0.013	3.47±5.81	0.065
Female	7.91±4.23		5.86±4.76
Age (year)	-0.262	0.03	-0.091	0.457
FAB classification
M0	4.41±2.78	0.51	2.85±3.28	0.11
M2	7.98±4.47		6.07±5.07
M3	5.81±3.2		1.77±3.79
M4	6.7±6.24		5.41±7.53
M5	5.12±4.76		4.19±5.21
M6	-0.062±2.13		-2.44±8.78
M7	-------		------
Blood count
WBC (10^3/µL)	0.13	0.018	-0.192	0.114
HB (g/dl)	0.13	0.286	0.05	0.681
PLT (10^3/µL)	0.1	0.414	0.029	0.813
LDH (U/L)	-0.235	0.249	0.289	0.152
Response rate after treatment
CR	6.77±5.07	0.397	5.18± 6.06	0.605
NCR	6.18±4.32		4.06±4.77

FAB: French-American-British; WBC: White blood cell; HB: Hemoglobin; PLT: Platelets; LDH: Lactate dehydrogenase; CR: Complete remission; NCR: Not complete remission.

1. Döhner H, Estey EH, Amadori S, Appelbaum FR, Büchner T, Burnett AK et al. Diagnosis and management of acute myeloid leukemia in adults: recommendations from an international expert panel, on behalf of the European LeukemiaNet. Blood. 2010;115(3):453-74.
2. Ridgway D. The first 1000 dendritic cell vaccinees. Cancer Investig. 2003;21(6):873-86.
3. Estey EH. General approach to, and perspectives on clinical research in, older patients with newly diagnosed acute myeloid leukemia. Semin Hematol.2006; 43(2): 89-95.
4. Mavromatis B, Cheson BD. Monoclonal antibody therapy of chronic lymphocytic leukemia. J Clin Oncol. 2003;21(9):1874-81.
5. Hagenbeek A, Gadeberg O, Johnson P, Pedersen LM, Walewski J, Hellmann A et al. First clinical use of ofatumumab, a novel fully human anti-CD20 monoclonal antibody in relapsed or refractory follicular lymphoma: results of a phase 1/2 trial. Blood. 2008;111(12):5486-95.
6. Ibrahem L, Mahfouz R, Elhelw L, Abdsalam EM, Soliman R. Prognostic significance of DNMT3A mutations in patients with acute myeloid leukemia. Blood Cells Mol Dis. 2015;54(1):84-9.
7. Li K, Lv XX, Hua F, Lin H, Sun W, Cao WB et al. Targeting acute myeloid leukemia with a proapoptotic peptide conjugated to a toll‐like receptor 2‐mediated cell‐penetrating peptide. Int J Cancer Res. 2014;134(3):692-702.
8. Nasrollahi SA, Taghibiglou C, Azizi E, Farboud ES. Cell‐penetrating peptides as a novel transdermal drug delivery system. Chem Biol Drug Des. 2012;80(5):639-46.
9. Charo IF, Ransohoff RM. The many roles of chemokines and chemokine receptors in inflammation. NEJM. 2006;354(6):610-21.
10. Verge GM, Milligan ED, Maier SF, Watkins LR, Naeve GS, Foster AC. Fractalkine (CX3CL1) and fractalkine receptor (CX3CR1) distribution in spinal cord and dorsal root ganglia under basal and neuropathic pain conditions. Eur J Neurosci. 2004;20(5):1150-60.
11. Corcione A, Ferretti E, Pistoia V. CX3CL1/fractalkine is a novel regulator of normal and malignant human B cell function. J Leukoc Biol. 2012;92(1):51-8.
12. D'Haese JG, Demir IE, Friess H, Ceyhan GO. Fractalkine/CX3CR1: why a single chemokine-receptor duo bears a major and unique therapeutic potential. Expert Opin Ther. Targets. 2010;14(2):207-19.
13. Sugiyama H, Inoue K, Ogawa H, Yamagami T, Soma T, Miyake S et al. The expression of IL-6 and its related genes in acute leukemia. Leuk Lymphoma. 1996;21(1-2):49-52.
14. Park J, Tadlock L, Gores GJ, Patel T. Inhibition of interleukin 6–mediated mitogen‐activated protein kinase activation attenuates growth of a cholangiocarcinoma cell line. Hepatology. 1999;30(5):1128-33.