Received 2021-12-19

Revised 2022-01-25

Accepted 2022-04-24

Introduction

Approximately two million new cases of colorectal cancer (CRC) are diagnosed every year, making it the third most common cancer and the fourth most common cause of cancer-related death, with 700,000 deaths annually [1, 2]. Since there is mostly no distinct symptom, and the lower abdominal signs are common and often associated with non-neoplastic conditions, CRC diagnosis is challenging in all health systems. Colonoscopy is a common method of CRC diagnosis, which is an invasive
procedure [3]. Following the cancer diagnosis, the staging process determines whether the CRC has remained within the intestine or has spread to other parts of the body [4]. Metastasis is a complex process involving the dissociation of tumor cells from the primary tumor, invasion, migration, entrance into blood vessels, survival in the blood vessels, entrance to the parenchymal tissue of the target organ, and the formation of a colony in the secondary location [5]. The epithelial-mesenchymal transition (EMT) is a process happening during development, fibrosis, and wound healing. It can also play a role in preserving cancer and inducing metastasis by changing the cell-to-cell connection and cytoskeleton in the extracellular matrix and releasing epithelial cells from the peripheral tissue [6, 7]. Transcription factors facilitate EMT by repressing the promoters of the tight junction proteins [8-10]. Claudins, along with occludin, are the most important proteins in the tight junction (zonulae occludent) structure [11, 12], and their abnormal expression is an indicator of increased invasion and reduced cell adhesion [13, 14]. For instance, loss of occludin was confirmed to lead to the progression of human breast cancer [15]. In another study, occludin expression was analyzed in human colorectal liver metastasis, and significant downregulation of occludin expression was seen in tumoral samples [16]. Moreover, the increased expression of
claudin-1, -3, and -4 are associated with tumor depth in the CRC tissues [17, 18]. Also, Mandle et al. evaluated the impacts of calcium and vitamin D on tight junction proteins of the CRC patients under treatment and found increased expression of claudin-1 and occludin [19].

Considering the increasing frequency of CRC and metastasis–which causes about 90% of cancer deaths–early detection of CRC is helpful to offer the appropriate treatment interventions and consequently control the
disease [20]. In addition, since the current standard CRC diagnostic methods are invasive, identifying biomarkers indicating invasive cells is important for prophylaxis and treatment. The present study aimed to assess the changes in the expression of claudin and occludin in different stages of CRC samples to identify diagnostic biomarkers and address the correlation of the EMT phenomenon with metastasis.

Materials and Methods

Tissue Samples Collections

The present case-control study was performed on patients who were referred to the Cancer Institute of Imam Khomeini Hospital, Tehran, Iran. Briefly, 38 tissue specimens from patients with CRC and three normal samples were randomly selected from the National Tumor Bank of Iran, affiliated with the Cancer Research Institute. The normal samples were from adjacent tissues far from the margin of tumor tissues from the same patients and were collected as controls to compare with tumor samples regarding gene expression. The collected tissue samples were from different colon regions, including the rectosigmoid, rectum, sigmoid colon, descending colon, transverse colon, ascending colon, and cecum. A pathologist evaluated all the histological information of the samples, including the stage of disease, grade, size, and metastasis. Hence, the TNM staging system (T indicates tumor size, N expresses lymph node involvement, and M means metastasis) was applied to assess the cancer stage. Tissue samples were stored at -80 °C after dissection to prevent RNA degradation.

RNA Extraction, cDNA Synthesis, and Quantitative Real-Time Polymerase Chain Reaction (PCR)

The RNA was extracted using an easy-BLUE RNA extraction kit (iNtRON Biotechnology, Seoul, Korea). The optical density and absorption of RNA were measured at a wavelength of 260 and 280 nm by a nanodrop machine (Spectrophotometer, 2000, Thermo Fisher Scientific Inc., Wilmington, USA). Samples with a 260/280 ratio equal to or greater than 1.7 were chosen to synthesize the complementary DNA. On agarose gel electrophoresis, RNA revealed its good quality. Then, the cDNA was prepared using the Random Hexamer primer. Table-1 shows the PCR primers designed by Primer3
software [21] for claudin and occludin as targets and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the housekeeping gene for qPCR. Real-time PCR (Rotor-Gene Q real-time PCR cycler, QIAGEN Inc., USA) was performed (initial denaturation in 95 °C for 15 minutes, and denaturation in 95 °C for 15 seconds, annealing for 1 minute for claudin and occludin in 55 °C and 60 °C, respectively, and elongation in 72 °C for 20 seconds in 40 cycles) to get the Ct (cycle threshold) values to estimate the fold change in expression of the desired genes [22].

Ethical Considerations

All procedures performed in this study were in accordance with the ethical standards of the Cancer Research Institute, Tehran University of Medical Sciences (ethical approval: IR.TUMS.IKHC.REC.1401.018), and informed consent was obtained from all patients.

Statistical Analysis

To evaluate any changes in the gene expression and to make comparisons, the relative expression software tool (REST, QIAGENE Inc., USA) was used [23]. This method helps with standardizing the expression of target genes. Finally, the relative gene expression data analysis was performed using the comparative Ct(2-ΔΔCT) method [24]. Also, the t-test was performed using RStudio 1.2.1335 [25] to evaluate the difference between the mean expression of claudin and occludin and the disease stage, tumor grade, tumor size, and metastasis. A P-value≤0.05 was considered as significant difference.

Results

Histopathological Characteristics of Patients

Histopathological characteristics of patients were received from the National Tumor Bank of Iran. The mean age of patients was 55 years, with the maximum and minimum ages of 79 and 16 years, respectively. The patient clinical characteristics are presented in Table-2.

Claudin and Occludin Expression

We used the Ct values of GAPDH and each claudin and occludin gene to estimate the fold change in gene expression using 2-ΔΔCT. Then, we transformed the data using square root to have homogeneous data with normal distribution. Figure-1 shows the fold change of gene expression for claudin and occludin in normal (control) and CRC samples. We observed that most of the samples had lower occludin expression than normal tissues, while the majority of the samples had claudin expression similar to normal tissues.

As shown in Figure-2A, the mean claudin expression in CRC was lower than in the control group (0.6±0.73 vs. 1.01±0.16). Also, according to Figure-2B, the mean occludin expression in the patients group (0.23±0.42) was lower than in the control group (1.01±0.2). The t-test indicated that claudin and occludin expression were significantly different between the control and patients groups (P=0.02 and P=0.005, respectively).

Regarding claudin, the mean gene expression in normal tissues was 1.01±0.16. Although the mean claudin expression was increased in stage I (1.66±1.74, Figure-3A), it decreased in stages II (0.48±0.43), III (0.48±0.52), and IV (0.85±1.19). Regarding occludin, the mean expression was decreased in stages I (0.70±0.97), II (0.19±0.29), III (0.22±0.43), and IV (0.02±0.009) compared to the normal samples (1.01±0.2, Figure-3A). There was a significant difference in claudin expression level between normal samples and stages II and III (P=0.005 and 0.007, respectively). Moreover, occludin expression was significantly different between the normal samples and stages II, III, and IV (P=0.004, P=0.002, and P=0.013, respectively).

As mentioned in Figure-3B, mean claudin expression decreased in grades I (0.63±0.53), II (0.55±0.63), III (0.33±0.21), and IV (0.12), while it increased in grade X (1.97±2.36) compared to normal samples (1.01±0.16). Also, the occludin expression decreased in grades I (0.36±0.51), II (0.11±0.22), III (0.15±0.19), IV (0.02), and X (0.9±1.28) compared to normal samples (1.01±0.2, Figure-3B). The t-test confirmed the statistically significant difference in claudin expression between the normal samples and grades II and III (P=0.02 and P=0.003, respectively) and occludin expression between the normal samples and grades I, II, and III (P=0.007, P=0.006, and P=0.003, respectively).

Figure-3C represents the change in mean gene expression in different metastasis states. Data showed that claudin expression for normal samples was 1.01±0.16, while it significantly decreased for non-metastatic (0.63±0.73), metastatic (0.85±1.19), and tissues with metastasis probability (0.37±0.55). In addition, occludin expression decreased in all metastasis states of M0 (0.28±0.47), Mx (0.08±0.1), and M1 (0.58±1.1) compared to normal samples (1.01±0.19, Figure-3C).

Figure-3D shows the mean gene expression change across three tumor size categories. Regarding claudin, the mean expression decreased in tumors smaller than 3 cm (0.77±1.22), between 3 to 5 cm (0.51±0.53), and greater than 5 cm (0.61±0.61) compared with normal tissue (P=0.009). Also, occludin expressions were decreased in all three tumor size categories compared to normal samples (Figure-3D).

Discussion

We compared the fold change in gene expression between normal and CRC tumor tissues for claudin and occludin, which are the most critical proteins in tight
junctions [26]. Although we had a limitation in control sample size due to the limited available normal mucosae far from the margin of tumor tissues in the tumor bank, our results indicated that the mean expression of both claudin and occludin decreased in CRC samples compared to normal tissues. Regarding the stage of the disease, we observed significant differences for stages II and III compared to normal samples, which can be attributed to the lower number of samples in other stages. The changes in claudin and occludin expression levels may have prognostic significance in patients with CRC, as it was identified in other cancers. Ganjzadeh et al. revealed that an increase in the expression level of the occludin gene in breast cancer tissues was considered to one of the effective factors in tissue transformation toward the cancerous phase [27].

Moreover, Park et al. suggested that occludin expression was highly related to the development of peritumoral brain edema and can consider as a prognostic factor [28]. Salehi et al. showed that the downregulation of occludin expression in patients with melanoma was an authentication mark of cancer progression [29]. In addition, Phattarataratip et al. indicated that claudin-7 expression could effectively predict the prognosis of oral squamous cell
carcinoma [30]. Furthermore, it was proposed that claudin-1 is probably a molecular marker in squamous cervical cancer and potentially can be a diagnostic, prognostic, and therapeutic marker [31]. Also, higher expression of claudin-3 was observed among patients with metastasis of prostate
cancer [32].

In the current study, we showed significant differences in occludin expression in all available tumor sizes compared to normal samples; however, significant differences in claudin expression were seen only in the tumor size 3 to 5 cm. Indeed, the expression level change with increased tumor size can indicate CRC progress. Evidence suggested that the protein expression of claudin 1, 3, 4, 5, and 7 could associated with tumor growth patterns in colon carcinoma; hence, it may have a progressive effect on colon carcinoma development and can consider a tumor marker [33]. Niknami et al. mentioned that vimentin expression decreased in CRC with larger tumor sizes, and increased expression of fibronectin was correlated with high tumor stages [34].

The significant decrease in occludin expression in samples with metastasis can indicate that with loss of occludin, the metastasis can be facilitated as a result of a weakened tight junction [35]. In the current study, the number of metastatic specimens was insufficient to make a reasonable conclusion; however, as shown previously, claudin protein was highly expressed in liver metastases of colorectal adenocarcinoma [36].

Conclusion

Based on the results of this study, a significant change in the expression level of claudin and occludin in CRC specimens compared to normal samples was specified, which might be useful and reliable for the detection of CRC and its probable prognosis.

Acknowledgments

This study was supported by the Cancer Research Center (CRC) of the Tehran University of Medical Sciences (grant number: 93-02-180-25822).

Conflict of Interest

The authors have no conflict of interest in this work.

 Correspondence to: Reza Shirkoohi, Cancer Biology Research Center, Cancer Research Institute, Imam Khomeini Hospital Complex, Tehran University of Medical Sciences, Tehran, Iran Telephone Number: +982166940021 Email Address: rshirkoohi@tums.ac.ir

Table 1. Primers Used for Polymerase Chain Reaction

Genes	Sequences (5´–3´)	Primer length (kb)	Product length (kb)
Claudin	F: TCGATACAATGGCACAGTGG	20	182
	R: CAATCCCGCTATTGTGGTTT
Occludin	F: TCCAATGGCAAAGTGAATGA	20	182
	R: GCAGGTGCTCTTTTTGAAGG
GAPDH	F: TCACCAGGGCTGCTTTTAAC	20	152
	R: GACAAGCTTCCCGTTCTCAG

GAPDH: Glyceraldehyde-3-phosphate dehydrogenase

Table 2. Patients Histopathological Characteristics

Variables		Number	Percent
Age, y	<40	6	15.78
	≥40	32	84.22
Tumor size (cm)	<3	8	21.05
	3≤size≤5	16	42.1
	>5	14	36.85
Grade	I	11	28.94
	II	18	47.39
	III	6	15.78
	IV	1	2.63
	X	2	5.26
Stage	I	3	7.89
	II	16	42.1
	III	16	42.1
	IV	3	7.91
Metastasis	M0	29	76.31
	Mx	6	15.78
	M1	3	7.91

Mx: Properly metastasis

Figure 1. The folded change of claudin and occludin expression (sqrt) across all the samples

Figure 2. The mean gene expression for claudin (A) and occludin (B) in studied samples

Figure 3. The mean fold change in claudin and occludin expressions across different stages (A), grades (B), metastasis state (C), and tumor size (D) compared to normal samples

References

1. Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, 2002. CA Cancer J Clin. 2005;55(2):74-108.
2. Stewart BW, Wild CP. Lyon: International Agency for Research on Cancer. World Cancer Report; 2014.
3. Vega P, Valentín F, Cubiella J. Colorectal cancer diagnosis: Pitfalls and opportunities. World J Gastrointest Oncol. 2015;7(12):422.
4. NCI. Adult Treatment Editorial Board. 2022 [Accessed 2016 June 8]. Available from: https://www.cancer.gov/types/colorectal/patient/rectal-treatment-pdq.
5. Egeblad M, Werb Z. New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer. 2002;2(3):161-74.
6. Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med. 1995;1(1):27-30.
7. Radisky DC. Epithelial-mesenchymal transition. J Cell Sci. 2005;118(19):
   4325-6.
8. Craene BD, Berx G. Regulatory networks defining EMT during cancer initiation and progression. Nat Rev Cancer. 2013;13(2):97-110.
9. Chakrabarti R, Hwang J, Andres Blanco M, Wei Y, Lukačišin M, Romano RA, et al. Elf5 inhibits the epithelial–mesenchymal transition in mammary gland development and breast cancer metastasis by transcriptionally repressing Snail2. Nat Cell Biol. 2012;14(11):
   1212-22.
10. Denker BM, Nigam SK. Molecular structure and assembly of the tight junction. Am J Physiol Renal Physiol. 1998;274(1):F1-9.
11. Hou J, Konrad M. Claudins and Renal Magnesium Handling. Curr Top Membr. 2010;65:151-76.
12. Furuse M. Introduction: claudins, tight junctions, and the paracellular barrier. In Current Topics in Membranes. Boston: Elsevier; 2010. p. 1-19.
13. Zhu L, Han J, Li L, Wang Y, Li Y, Zhang S. Claudin family participates in the pathogenesis of inflammatory bowel diseases and colitis-associated colorectal cancer. Front Immunol. 2019;10:1441.
14. Wang X, Tully O, Ngo B, Zitin M, Mullin JM. Epithelial tight junctional changes in colorectal cancer tissues. Sci World J. 2011;11:826-41.
15. Martin TA, Mansel RE, Jiang WG. Loss of occludin leads to the progression of human breast cancer. Int J Mol Med. 2010;26(5):723-34.
16. Orbán E, Szabó E, Lotz G, Kupcsulik P, Páska C, Schaff Z, et al. Different expression of occludin and ZO-1 in primary and metastatic liver tumors. Pathol Oncol Res. 2008;14(3):299-306.
17. Huo Q, Kinugasa T, Wang L, Huang J, Zhao J, Shibaguchi H, Kuroki M, Tanaka T, Yamashita Y, Nabeshima K, Iwasaki H. Claudin-1 protein is a major factor involved in the tumorigenesis of colorectal cancer. Anticancer Res. 2009;29(3):851-7.
18. De Oliveira SS, De Oliveira IM, De Souza W, Morgado-Díaz JA. Claudins upregulation in human colorectal cancer. FEBS Lett. 2005;579(27):6179-85.
19. Mandle HB, Jahan FA, Bostick RM, Baron JA, Barry EL, Yacoub R, et al. Effects of supplemental calcium and vitamin D on tight‐junction proteins and mucin‐12 expression in the normal rectal mucosa of colorectal adenoma patients. Mol Carcinog. 2019;58(7):1279-90.
20. Adiseshaiah PP, Patel NL, Ileva LV, Kalen JD, Haines DC, McNeil SE. Longitudinal imaging of cancer cell metastases in two preclinical models: A correlation of noninvasive imaging to histopathology. Int J Mol Imaging. 2014;2014:102702.
21. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, et al. Primer3—new capabilities and interfaces. Nucleic Acids Res. 2012;40(15):e115.
22. Wong ML, Medrano JF. Real-time PCR for mRNA quantitation. Biotechniques. 2005;39(1):75-85.
23. Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002;30(9):e36.
24. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 2001;25(4):402-8.
25. Studio R. RStudio: Integrated development environment for R Version 0.98. 501. Newnes Boston, MA: 2012.
26. Gonzalez-Mariscal L, Betanzos A, Nava P, Jaramillo BE. Tight junction proteins. Prog Biophys Mol Biol. 2003;81(1):1-44.
27. Ganjzadeh F, Shirkoohi R. Association between occludin gene expression and clinical morphological characteristics in breast cancer. Tehran Univ Med J. 2015;73(1):18-23.
28. Park MW, Kim CH, Cheong JH, Bak KH, Kim JM, Oh SJ. Occludin expression in brain tumors and its relevance to peritumoral edema and survival. Cancer Res Treat. 2006;38(3):139-43.
29. Salehi P, Tafvizi F, Hesari KK. Low Expression of Occludin in the Melanoma Patient. Iran J Pathol. 2019;14(4):272.
30. Phattarataratip E, Sappayatosok K. Expression of claudin-5, claudin-7 and occludin in oral squamous cell carcinoma and their clinico-pathological significance. J Clin Exp Dent. 2016;8(3):e299.
31. Hoellen F, Waldmann A, Banz Jansen C, Holtrich U, Karn T, Oberländer M, et al. Claudin 1 expression in cervical cancer. Mol Clin Oncol. 2017;7(5):880-4.
32. Ye X, Zhao L, Kang J. Expression and significance of PTEN and Claudin 3 in prostate cancer. Oncol lett. 2019;17(6):5628-34.
33. Ahmad A, Befekadu R, Askari S, Strömberg VH. Decreased Expression of Claudin 1, 3, 4, 5 and 7: A New Prognostic Marker in Colon Carcinoma. J Gastrointest Cancer Stromal Tumors. 2016;1:105.
34. Niknami Z, Eslamifar A, Emamirazavi A, Ebrahimi A, Shirkoohi R. The association of vimentin and fibronectin gene expression with epithelial-mesenchymal transition and tumor malignancy in colorectal carcinoma. EXCLI J. 2017;16:1009.
35. Osanai M, Murata M, Nishikiori N, Chiba H, Kojima T, Sawada N. Epigenetic silencing of occludin promotes tumorigenic and metastatic properties of cancer cells via modulations of unique sets of apoptosis-associated genes. Cancer Res. 2006;66(18):9125-33.
36. Holczbauer Á, Gyöngyösi B, Lotz G, Szijártó A, Kupcsulik P, Schaff Z, et al. Distinct claudin expression profiles of hepatocellular carcinoma ad metastatic colorectal and pancreatic carcinomas. J Histochem Cytochem. 2013;61(4):
    294-305.