Quantitative Assessment of PALB2 and BRIP1

Genes Expression in the Breast Cancer Cell Line

under the Inuence of Tamoxifen

Hamed Kharrati-Koopaee 1, Seyed Taghi Heydari 2 , Mehdi Dianatpour 3, Kamran Bagheri Lankarani 2

1 Institute of Biotechnology, Shiraz University, Shiraz, Iran

2 Health Policy Research Center, Institute of Heath, Shiraz University of Medical Sciences, Shiraz, Iran

3 Department of Medical Genetics, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran

GMJ.2023;12:e2483

www.gmj.ir

 Correspondence to:

Seyed Taghi Heydari, Associate Professor in Biostatis-

tics, Health Policy, Research Center, Institute of Health,

Shiraz University of Medical Sciences, Shiraz, Iran.

Telephone Number: +989173034420.

Email Address: heydari.st@gmail.com

Received: 2022-05-21

Revised: 2022-06-06

Accepted: 2022-06-11

Abstract

Background: Breast cancer is considered one of the leading causes of mortality in the world.

Cancer incidence and consequently, drug consumption can strongly inuence gene expressions at

the transcriptome level. Therefore, the assessment of the candidate biomarkers’ gene expression

can accelerate the diagnosis process and increase the chance of treatment and remission.

In this regard, the quantitative assessment of Partner and localizer of BRCA2 (PALB2) and

BRCA1 Interacting Helicase 1 (BRIP1) genes expression in the breast cancer cell line under the

treatment of Tamoxifen (TAM) was executed in this study. Materials and Methods: MCF7 cells

were cultured as TAM-treated and control groups. RNA extraction and cDNA synthesis were

performed based on the instructions of provided kits. qPCR Hi-ROX Master Mix kit was applied

to the Quantitative Real-Time Polymerase Chain Reaction (Q-PCR). The outputs of Q-PCR were

analyzed by REST statistical software. Results: Outcomes derived from data analysis of BRIP1

gene expression did not show any signicant dierence between the gene expression of control

and TAM-treated groups. The expression of PALB2 was signicantly higher in the TAM-treated

group compared to the control group (P<0.05). Conclusion: Our ndings showed a signicant

alteration between PALB2 gene expression in the TAM-treated breast cancer cell line and the

control cell line. The quantitative assessment of mentioned genes as possible markers could be

considered a non-invasive method for breast cancer in the processes of prognostic evaluations,

screening, and treatment monitoring.[GMJ.2023;12:e2483] DOI:10.31661/gmj.v12i.2483

Keywords: Biomarkers; Gene expression; Breast cancer

Introduction

Breast cancer is known as the second lead-

ing cause of cancer-related death among

females [1].

The WHO reported that in 2020, there were

2.3 million women diagnosed with breast

cancer and 685,000 deaths around the world.

Breast cancer is highly heterogeneous, which

occurs due to the cross impacts of hereditary

and environmental risk factors. In addition, it

is pathologically classied based on the key

protein expressions identied through immu-

nohistochemistry [2].

Estrogen receptor (ER, ESR1 gene) that

is called estrogen receptor-positive (ER+),

GMJ

This is an open-access article distributed

under the terms of the Creative Commons

Attribution 4.0 International License

(http://creativecommons.org/licenses/by/4.0/)

Email:info@gmj.ir

Kharrati-Koopaee H, et al. PALB2 and BRIP1 Genes Expression under Tamoxifen

2GMJ.2023;12:e2483

www.gmj.ir

progesterone receptor (PR, PGR gene), and

human epidermal growth factor receptor 2

(HER2, ERBB2 gene) are included in the

aforementioned classication.

Tumors without these protein markers are

called triple-negative breast cancer (TNBC)

[3].

Patients with breast cancer can be treated

through surgical methods, ray methods, and

endocrine therapy (or anti-estrogen therapy).

Tamoxifen (TAM), the selective estrogen re-

ceptor modulator (SERM) that competes with

estrogens to connect to ER, as well as aro-

matase inhibitors (AIs), such as letrozole, are

implemented in endocrine therapy to block the

conversion of androgens into estrogens [4,5].

TAM is an ER antagonist, which has helped

millions of females with breast cancer since

50 years ago [5].

However, it comes with several issues in-

cluding drug resistance and consequent side

eects. Unfortunately, 30 to 40% of patients

are obstinate and show increased metastatic

cancer [6,7].

Because breast cancer is a heterogeneous

disease, identifying molecular markers, gene

expression proles, and genomic alteration

patterns are considered analytical tools neces-

sary for determining treatment outcomes and

choosing the best treatment approaches [8,9].

Therefore, it is very important to achieve a

good understanding of the cellular and molec-

ular pathways related to breast cancer devel-

opment and progression to improve the treat-

ment conditions and clinical outputs [10].

By interacting with the BRCA2 protein, the

tumor suppressor partner and localizer of

BRCA2 (PALB2) plays a critical part in repair-

ing DNA damage and preventing the growth

of tumors. The mutation in the structure of

PALB2 protein increases the risk of cancer by

14% and 35% among 50- and 70- year old in-

dividuals, respectively [11, 12].

Similarly, the mutant protein of BRCA2 among

80-year-old females increases the risk of can-

cer exposure by 72%. Furthermore, BRCA1

Interacting Helicase 1 (BRIP1) encodes a pro-

tein belonging to RecQ Helicase DEAH.

Similar to PALB2, this gene is on chromosome

17 and repairs DNA damage in a complemen-

tary gene action with BRCA2. Compared to

BRCA2, the importance of mutation in BRIP1

does not increase the risk of cancer exposure;

however, its product is recognized as a tumor

suppressor and also an oncogene protein [12,

13].

In this study, the performance and alterations

in gene expression of PALB2 and BRIP1, as

well as their roles in cancer progression are

investigated through conducting quantitative

assessments.

Materials and Methods

Cancer Cells Culture and Tamoxifen Treat-

ment Implementation

Experimental research was executed to an-

alyze gene expression in breast cancer cell

lines. MCF7 cells (National Cell Bank, Pas-

teur Institute of Iran) were cultured in RPMI

1640 (Bioidea Company) medium with pH

7.4.

The culture medium was supplemented with

10% heat-inactivated fetal bovine serum (Gib-

co-BRL), 1% penicillin (), and streptomycin

() (Biosera). Furthermore, the mentioned cells

were maintained in the 5% humidied atmo-

sphere at 37 .

Cell viability assays were also carried out by

conducting the colorimetric MTT assay (Sig-

ma-Aldrich-UK) for quantifying cell viability

[14].

After 24 hours of the cell culture process,

TAM (Iran-Hormone Company-Tehran, Iran)

was added to the culture mediums at the den-

sity of.

The sampling procedure was conducted after

12 hours for RNA extraction.

RNA Extraction and Qualitative and Quanti-

tative Assessments

Following the guidelines given by Denazist

Asia Company, RNA was extracted from a

cell culture medium. Then, the quantity and

quality of the extracted RNA were assessed

by 1% agarose gel electrophoresis and Nan-

oDrop. The absorption rate of extracted RNA

was assessed on the wavelengths of 280,

230, and 260, as well as rates of 260/280 and

260/230 [15].

Designing a Primer for Q-PCR

In this study, primers were designed by the

gene sequence of PALB2 and BRIP1 with the

PALB2 and BRIP1 Genes Expression under Tamoxifen Kharrati-Koopaee H, et al.

GMJ.2023;12:e2483

www.gmj.ir

accession numbers XM_017023673 and XM-

011525341 available in the NCBI database.

Also, Primer Quest software was implement-

ed [14].

To assure the specicity of primers, the

BLAST tool was applied in the NCBI data-

base. Finally, the synthesis of primers was

carried out by Macrogen Company, South Ko-

rea. It is noteworthy that GADPH was applied

as the internal control. The primer sequences

are provided in Table-1.

cDNA Synthesis and Determination of

Primers Annealing Temperature

DNaseI enzyme was used (Fermentas Compa-

ny) to remove the DNA contamination from

RNA extracted samples.DNaseI treatment

was carried out on the samples in 30 minutes

at 37 ○C.

Finally, of 50 milli-molar EDTA was added

to the solution and then, maintained at 65 for

10 minutes to inactivate the DNaseI enzyme.

cDNA synthesis was conducted at the nal vol-

ume of according to the kit instructions pro-

vided by Thermo Company. PCR reaction was

applied to the amplication of 112 bp fragment

of the GADPH gene to conrm the synthesis of

cDNAs.

The polymerase chain reaction was conducted

at the volume of; also, the reaction compo-

nents were autoclaved distilled water, master

mix, each primer at the concentration of 0.6

picomoles, and cDNA at the concentration of

100 nanograms. The amplied product was

conrmed using 1% agarose gel electropho-

resis.

Quantitative Real Time PCR

QPCR Hi-ROX Master Mix kit provided by

Biocompare Company (www.biocompare.

com) was applied to the Q-PCR in this study.

The kit manufacturer’s instructions were con-

sidered to determine the volume of reactants.

Table-2 represents the Q- PCR thermal cycles

of investigated genes.

Q-PCR Data Analysis

REST software and method were used to an-

alyze the expression data from Q-PCR [16].

The Kolmogorov–Smirnov and the Shapiro–

Wilk tests were used to analyzing the normal-

ity of the expression data.

Dierences between treatments with three

replications including the TAM-treated cell

line and TAM-free cell line were tested us-

ing the independent T-test via SPSS software

(Version 16; SPSS Inc., Chicago, USA) at the

signicant level of 0.05 (P<0.5).

Ethics approval

This study was approved by the ethics com-

mittee of Shiraz University of Medical

Sciences (IR.SUMS.REC.1400.293).

Results

Qualitative and Quantitative Assessments of

RNA extraction

Agarose gel electrophoresis was used to qual-

ify RNA after extraction. The presence of 18s

and 28s fragments and the absence of extra

bands in the extracted samples indicated the

appropriate RNA quality (Figure-1).

Table 1. Sequences of Investigated Genes Primers for Gene Expression Assessment

Gene Length of pieces (bp) Primers sequence

PALB2 133

F: 5´-AGGATCTCTCACCGCAGCTAA-3´

R: 5´- TCAGGCCCAACATCAAGTGTG-3´

BRIP1 144

F: 5’- CTTACCCGTCACAGCTTGCTA-3’

R: 5’- CACTAAGAGATTGTTGCCATGCT -3’

GADPH 112

F: 5’-CTCTCTGCTCCTCCTGTTCG-3`

R: 5’-ACGACCAAATCCGTTGACTC-3’

4GMJ.2023;12:e2483

www.gmj.ir

Kharrati-Koopaee H, et al. PALB2 and BRIP1 Genes Expression under Tamoxifen

The quantitative assessment of extracted

RNA, as well as the determination of ap-

propriate quantities required for generating

cDNA, were carried out using NanoDrop.

The outcomes revealed that all RNA extracted

samples have appropriate quality and quantity

for cDNA synthesis.

Conrmation of cDNA synthesized

Following Nano dropping and determining

the concentrations of the samples, related

cDNA was generated and then the PCR pro-

cess was conducted using the internal control

gene primers. Finally, the product was investi-

gated using the agarose gel (Figure-2).

The amplication of the 112 bp fragment of

the GADPH gene demonstrated that cDNA

synthesis was performed correctly.

Results of Gene Expression Measurement

The results of the melting curve were applied

to ensure the Q-PCR accuracy and precise

amplication of genes under investigation.

A peak in the melting curve of each designed

primer showed the specic amplication of

genes. Figure-3 shows the melting curve of

PALB2 and BRIP1 genes. The normality of

expression data was approved by normality

tests.

Results of investigating gene expression data

revealed that BRIP1 gene expression of the

control and TAM-treated cell lines were not

signicantly dierent.

In contrast, alterations in PALB2 gene expres-

sion of the TAM-treated and control groups

were associated with a signicant increase

(P<0.05, Figure-4). Results revealed that

PALB2 gene expression in TAM-treated and

control cell lines were respectively deter-

mined to be 7.1836 and 3.810.22.

Discussion

This study revealed that TAM treatment can

increase the expression of the PALB2 gene

compared to the control group in the MCF7

cell line. Investigations indicated that PALB2

increases concurrently with the progression of

breast cancer, which is rational due to its tu-

mor suppression role [17-19]. Wu et al. (2020)

found that PALB2 is the inseparable part of

the required BRCA series for the process of

DNA repair [19]. These ndings may be ex-

plained by the fact that BRCA2 and PALB2

proteins are directly connected to BRCA1

and act as the DNA repair complexes [13].

Another interpretation could be that there is a

putative mechanism as to the PALB2 expres-

Table 2. The Quantitative Real Time Polymerase Chain Reaction (Q-PCR) Thermal Cycles of

Investigated Genes

Gene Number of cycles Time Temperature

(○C) Stage

PALB2

1 12 min 94 Initial denaturation

1 min 94

Annealing

50 sec 55

40 sec 72

190 sec 72 Final extension

BRIP1

13 min 95 Initial denaturation

50 sec 95

Annealing

40 sec 57

5 min 72

190 sec 72 Final extension

GMJ.2023;12:e2483

www.gmj.ir

PALB2 and BRIP1 Genes Expression under Tamoxifen Kharrati-Koopaee H, et al.

Figure 1. The conrmation of RNA extraction by

gel electrophoresis.

Figure 2. Electrophoresis results of amplication

of GADPH gene (112 bp) in order to conrmation

of cDNA synthesis.

Figure 3. Melting-curves of PALB2 and BRIP1 genes to assure the accuracy of the Quantitative Real Time

Polymerase Chain Reaction (Q-PCR).

6GMJ.2023;12:e2483

www.gmj.ir

Kharrati-Koopaee H, et al. PALB2 and BRIP1 Genes Expression under Tamoxifen

Figure 4. Di󰀨erences in PALB2 and BRIP1 genes expression in Tamoxifen (TAM)-treated and control

MCF7 cell line. Di󰀨erent letters indicate statistically signicant di󰀨erences at P<0.05. Bars with common

letters show no signicant di󰀨erences.

sion level regulation in the epigenetic system

with CpG island methylation as the most rel-

evant one. As an example, there is a 92.5%

promoter methylation and this hypermethyl-

ated state is accompanied by an increase in

PALB2 expression level in plasma samples

of breast cancer patients [15]. In major stud-

ies, 18 target genes such as BRCA1, BRCA2,

and PALB2 were reported as biomarkers for

cancer progression and development [20,

21]. Several investigations have tried to show

the eect of TAM on gene expression at the

transcriptome level [22-24]. However, not all

molecular mechanisms and functions of TAM

have been fully described [25]. According to

the result of this study and insights into the

mechanisms of TAM, it can be claimed that

an increase in PALB2 gene expression under

TAM therapy is one of the possible mecha-

nisms to avoid cancer development.

BRIP1 gene with BRCA1/2 contributes to

regulating DNA repair and cell cycle. Howev-

er, BRIP1 has been shown to have a dual func-

tion of an oncogene and a tumor suppressor.

As an example, the BRIP1 candidate gene is

classied as an intermediate risk factor based

on the relative risk [26].

Furthermore, the BRIP1 gene is known as

a biomarker for breast cancer diagnosis and

treatment monitoring. However, our results

indicated that TAM had no signicant eect

on BRIP1 gene expression between control

and TAM-treated cell lines. A possible expla-

nation might be the one-time point evaluation

of the BRIP1 gene expression. BRIP1 gene

may be an early or late response gene. In ad-

dition, TAM therapy is a targeted therapy that

blocks estrogen receptors. Thus, activation

of the estrogen signaling pathways involves

many gene networks and protein-protein in-

teractions that contribute to the regulation of

gene expression [23]. Therefore, the investi-

gation of gene expressions at the transcrip-

tome level by RNA-seq data is crucially es-

sential to describe the BRIP1 gene expression

under TAM therapy.

Limitation

Here, the expression of two candidate genes

under TAM treatment in the MCF7 cell line

has been investigated. However, TAM can af-

fect the expression of many candidate genes

in breast cancer.

Conclusion

The quantitative assessment of the PALB2

gene as a potential marker could be consid-

GMJ.2023;12:e2483

www.gmj.ir

PALB2 and BRIP1 Genes Expression under Tamoxifen Kharrati-Koopaee H, et al.

References

1. Hammond MEH, Hayes DF, Dowsett M,

Allred DC, Hagerty KL, Badve S, et al.

American Society of Clinical Oncology/

College of American Pathologists guideline

recommendations for immunohistochemical

testing of estrogen and progesterone receptors

in breast cancer (unabridged version). Arch

Pathol Lab Med. 2010;134(7): e48-e72.

2. Mohammadpour A, Jahangirian E, Moharra-

mi T, Goljah Rad G, Javanparast Sheikhani L,

Taghizadeh S. Breast Cancer, Genetic Factors

and Methods of Diagnosis. Sarem J Reprod

Med. 2020;4(4):198-207.

3. Barzaman K, Karami J, Zarei Z, Hosseinza-

deh A, Kazemi MH, Moradi-Kalbolandi S,

et al. Breast cancer: Biology, biomarkers,

and treatments. Int Immunopharmacol. 2020;

84:106535.

4. Klinge C. Non-Coding RNAs in Breast Can-

cer: Intracellular and Intercellular Communi-

cation. Non-Coding RNA. 2018;4(4):40.

5. Burstein HJ, Temin S, Anderson H, Buch-

holz TA, Davidson NE, Gelmon KE, et al.

Adjuvant endocrine therapy for women with

hormone receptor–positive breast cancer:

American Society of Clinical Oncology clini-

cal practice guideline focused update. J Clinic

Oncol. 2014;32(21):2255.

6. Jordan VC. Tamoxifen: a most unlikely

pioneering medicine. Nat Rev Drug Discov.

2003;2(3):205.

7. Ring A, Dowsett M. Mechanisms of tamox-

ifen resistance. Endocr Relat Cancer.

2004;11(4):643-58.

8. Piggott L, da Silva AM, Robinson T, San-

tiago-Gómez A, Simões BM, Becker M,

et al. Acquired resistance of ER-positive

breast cancer to endocrine treatment confers

an adaptive sensitivity to TRAIL through

post-translational downregulation of c-FLIP.

Clin Cancer Res. 2018: 1381.2017.

9. Shou J, Massarweh S, Osborne CK, Wake-

ling AE, Ali S, Weiss H, et al. Mechanisms

of tamoxifen resistance: increased estro-

gen receptor-HER2/neu cross-talk in ER/

HER2–positive breast cancer. J Natl Cancer I.

2004;96(12):926-35.

10. Li X, Rouchka EC, Brock GN, Yan J,

O’Toole TE, Tieri DA, et al. A combined

approach with gene-wise normalization

improves the analysis of RNA-seq data in

human breast cancer subtypes. PloS one.

2018;13(8): e0201813.

11. Kwei KA, Kung Y, Salari K, Holcomb IN,

Pollack JR. Genomic instability in breast can-

cer: pathogenesis and clinical implications.

Mol Oncol. 2010;4(3):255-66.

12. Antoniou AC, Casadei S, Heikkinen T,

Barrowdale D, Pylkäs K, Roberts J, Lee

A, Subramanian D, De Leeneer K, Fostira

F, Tomiak E. Breast-cancer risk in families

with mutations in PALB2. New Engl J Med.

2014;371(6):497-506.

13. Amirhamzeh SA, Esfahani K, Salahshourifar

I, Moslemi E. Evaluation of PALB2 Gene

Expression in Breast Cancer. Journal of Sci-

ered a non-invasive method for breast cancer

in the processes of prognostic evaluations,

screening, and treatment monitoring.

The relationship between the amount of men-

tioned genes expression and drug inuence

can be explored more extensively through

more accurate investigations, such as evalu-

ating the whole transcriptome and RNA-seq,

to be applied as appropriate biomarkers and

consequently, improve the non-invasive diag-

nosis and treatment monitoring.

Acknowledgments

The research grant was provided by the Re-

search Deputy of Shiraz University of Med-

ical Sciences (number: 22863). The funding

body of the study did not play any role in the

design, collection, analysis, interpretation of

data, and writing the manuscript.

Conict of Interest

The authors declare that they have no conict

of interest.

8GMJ.2023;12:e2483

www.gmj.ir

Kharrati-Koopaee H, et al. PALB2 and BRIP1 Genes Expression under Tamoxifen

ences, Islamic Republic of Iran. 2020;31(1):

5-11.

14. Shaee E, Hesampour A. Quantitative study

of PALB2 and BRIP1 gene expression in the

population of Iranian women with Breast can-

cer compared to controls. Medic Sci J Islamic

Azad Uni. 2019; 28(4):283-289.

15. Kharrati-Koopaee H, Ebrahimie E, Dadpas-

and M, Niazi A, Esmailizadeh A. Genomic

analysis reveals variant association with high

altitude adaptation in native chickens. Sci

Rep. 2019;9(1): 9224.

16. Livak KJ, Schmittgen TD. Analysis of

relative gene expression data using real-time

quantitative PCR and the 2−ΔΔCT method.

Methods. 2001;25(4):402-8.

17. Li N, Zethoven M, McInerny S, et al. Con-

tribution of large genomic rearrangements in

PALB2 to familial breast cancer. implications

for genetic testingJournal of Medical Genet-

ics Published Online First. 2023; 60(2):112-

118.

18. Dorling L, Carvalho S, Allen J,

González-Neira A et al. Breast Cancer Risk

Genes - Association Analysis in More than

113,000 Women. N Engl J Med. 2021;

384(5):428-439.

19. Wu S, Zhou J, Zhang K, Chen H, Luo M, Lu

Y, Sun Y, Chen Y. Molecular mechanisms of

PALB2 function and its role in breast cancer

management. Fron Oncol. 2020; 28(10):301.

20. Mistry DA, French PW. Circulating Phos-

pholipids as Biomarkers of Breast Cancer:

A Review. Breast Cancer (Auckl). 2016;

10:191-196.

21. Thompson ER, Rowley SM, Li N, McInerny

S, Devereux L, Wong-Brown MW, et al.

Panel Testing for Familial Breast Cancer:

Calibrating the Tension Between Research

and Clinical Care. J Clin Oncol. 2016;

34:1455-59.

22. Huber-Keener KJ, Liu X, Wang Z, Wang Y,

Freeman W, Wu S, Planas-Silva MD, Ren X,

Cheng Y, Zhang Y, Vrana K, Liu CG, Yang

JM, Wu R. Dierential gene expression

in tamoxifen-resistant breast cancer cells

revealed by a new analytical model of RNA-

Seq data. PLoS One. 2012;7(7):e41333.

23. Men X, Ma J, Wu T, Pu J, Wen S, Shen J,

Wang X, Wang Y, Chen C, Dai P. Transcrip-

tome proling identied dierentially ex-

pressed genes and pathways associated with

tamoxifen resistance in human breast cancer.

Oncotarget. 2017; 9(3):4074-4089.

24. Xu E, Guan T, Hu M, Tong D, Ge R, Liu Y.

Establishment and transcriptome characteri-

zation of tamoxifen-resistant canine mamma-

ry gland tumor cells. Research in Veterinary

Science. 2022; 19(145):135-46.

25. Li Z, Yu D, Li H, Lv Y, Li S. Long noncoding

RNA UCA1 confers tamoxifen resistance in

breast cancer endocrinotherapy through reg-

ulation of the EZH2/p21 axis and the PI3K/

AKT signaling pathway. International journal

of oncology. 2019; 54(3):1033-1042.

26. Gupta I, Ouhtit A, Al-Ajmi A, Rizvi SG,

Al-Riyami H, Al-Riyami M, Tamimi Y.

BRIP1 overexpression is correlated with clin-

ical features and survival outcome of luminal

breast cancer subtypes. Endocrine connec-

tions. 2018;7(1):65-77.