Evaluation of Apoptosis-Related Genes and

Hormone Secretion Proles Using Three

Dimensional Culture System of Human Testicular

Organoids

Aghbibi Nikmahzar

, Farnaz Khadivi

, Morteza Koruji

3,4

, Mehrdad Jahanshahi

, Masoomeh Dehghan Tarazjani

Maryam Shabani

, Yasaman Abbasi

, Mehdi Abbasi



Department of Anatomy, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

Department of Anatomy, School of Medicine, Shahrekord University of Medical Sciences, Shahrekord, Iran

Stem Cell and Regenerative Center, Iran University of Medical Sciences, Tehran, Iran

Department of Anatomy, School of Medicine, Iran University of Medical Sciences, Tehran, Iran

Neuroscience Research Center, Department of Anatomy, Faculty of Medicine, Golestan University of Medical Sciences, Gorgan, Iran

Vali-E-Asr Reproductive Research Center, Family Research Institute, Tehran University of Medical Sciences, Tehran, Iran

Program in Neuroscience, Center to Advance Chronic Pain Research, Department of Neural and Pain Sciences, School of Dentistry,

University of Maryland, Baltimore, MD, United States

GMJ.2023;12:e2805

www.gmj.ir



Correspondence to:

Mehdi Abbasi, Enqelab Square, Qods Street, Poursina

Avenue, Tehran, Iran.

Telephone Number: (0098)2166419072

Email Address: abbasima@tums.ac.ir

Received 2022-11-11

Revised 2022-12-15

Accepted 2023-01-21

Abstract

Background: In reproductive biology, testicular organoids can be used to treat infertili-

ty and to study testicular development and spermatogonial stem cells (SSCs) dierentiation.

Generating organoid from primary cells is challenging. In this study, testicular organoids

were created using human primary testicular cells and evaluated the apoptotic gene expres-

sion and hormone secretion proles of the organoids. Materials and Methods: Primary hu-

man testicular cells were isolated using 2-step enzymatic digestion from three brain-dead do-

nors. Immunocytochemistry and ow cytometry analyses were performed to conrm human

SSCs. Isolated cells were cultured in three experimental groups: control group (2 dimension-

al (2D)), group 1 (organoid culture after 2D culture), and group 2 (organoid culture imme-

diately after enzymatic digestion). Testicular organoids were cultured in DMEM/F-12 media

supplemented with follicle-stimulating hormone (FSH) and fetal bovine serum (FBS) for four

weeks. After 24 hours and four weeks of culture, reverse transcription quantitative real-time

PCR (RT-qPCR) was used to investigate the relative expression of apoptotic genes (caspase

3, 9, Bax, and Bcl-2). At 24 hours, two weeks, and four weeks after culture, enzyme-linked

immunoassay (ELISA) was used to determine the testosterone and inhibin B concentrations.

Light microscopy and toluidine blue staining were also used for morphological analysis. Re-

sults: RT-qPCR results revealed that pro-apoptotic (caspase 3, 9, Bax) gene expression lev-

els were highest in group 2 after 24 h and four weeks of culture. In contrast, the expression

level of Bcl-2 (anti-apoptotic) was lower in group 2 compared to other groups. The hormone

secretion levels decreased in a time-dependent manner during the cultivation. According to

morphological evaluations, testicular organoids are compact, spherical structures with two

to three elongated cells organized along their border. Conclusion: Our ndings revealed that

the testicular organoid culture system maintained hormonal secretory abilities, demonstrat-

ing the function of Sertoli and Leydig cells in the absence of testis-specic environments.

[GMJ.2023;12:e2805] DOI:

10.31661/gmj.v12i0.2805

Keywords: Spermatogonial Stem Cells; Organoid Culture; Apoptosis; 3D Culture

GMJ

This is an open-access article distributed

under the terms of the Creative Commons

Attribution 4.0 International License

(http://creativecommons.org/licenses/by/4.0/)

Email:info@gmj.ir

Nikmahzar A, et al. Apoptosis Genes Expression in Human Testicular Organoids

GMJ.2023;12:e2805

www.gmj.ir

Introduction

emarkable advances in pediatric can-

cer therapy have signicantly increased

the life expectancy of cancer survivors by

up to 80% [1, 2]. Gonadotoxic chemothera-

py and radiotherapy treatment could damage

extremely spermatogonial stem cells (SSCs)

and can lead to male infertility [3]. Before

gonadotoxic medications, the most eective

strategy for maintaining male fertility in adult

men and young teenagers is sperm cryopres-

ervation [4]. Because spermatogenesis does

not begin until puberty, this strategy cannot be

used on prepubertal boys.

The only way to preserve a childs’ fertility is

to cryopreserve testicular tissue or SSCs prior

to cancer treatment [5]. Recently, in vitro sper-

matogenesis using two and three-dimensional

(2D and 3D) culture techniques has received

considerable attention to obtain functional

sperm and restore fertility after cryopreserva-

tion in these patients [6, 7]. Compared to 2D

conditions, 3D culture methods can provide

an ideal microenvironment for SSCs dier-

entiation and proliferation. They can create

a suitable condition like the testis microenvi-

ronment [8].

The organ-culture method, microuidic sys-

tems, air-liquid interface, 3D printing, and or-

ganoids are examples of 3D culture systems

[9]. Organoids are novel strategies generated

from tissue-specic stem cells and provide

the investigation of the developmental mech-

anisms in an in vitro system [10, 11]. These

structures have been used to create a variety

of tissues, including the intestine [12], brain

[13], liver [14], prostate [15], etc., that con-

duct distinct stages of organ development or

particular function of the organ [16]. Testic-

ular organoids appear as a proper model for

research because they can be easily manipu-

lated and rapidly reorganized from testicular

cells [9, 17].

Testicular organoids can investigate testicular

development, reorganization, and interactions

between dierent cell populations in the testis

niche. This is a helpful approach for identi-

fying the unknown factors involved in the

survival, proliferation, and dierentiation of

SSCs [9, 11, 17]. Previous experiments have

demonstrated that testicular organoid culture

systems can create appropriate conditions that

promote SSCs survival and dierentiation

[18, 19]. Testicular organoids’ can be generat-

ed using dierent techniques, and there is no

generally accepted protocol for testicular or-

ganoid culture. Three-layer gradient system,

hanging drop technique, and decellularized

testicular tissue fragments were utilized to

generate testicular organoids [17-20].

Previous testicular organoid studies have only

focused on animal models [19, 21] and plurip-

otent or immortalized Leydig and Sertoli cells

[18].

The organoids generation from immortalized

cells could not be transferred to humans. The

production of human testicular organoids

using primary human testicular cells has re-

ceived little attention due to the limited pro-

liferation ability and complex challenges in

testicular cell culture. Immortal cells are dif-

ferent from primary cultured cells. Since they

have undesired genetic alterations and dier-

ent molecular structures, which makes them

immortal.

The results of primary cell culture may be ob-

tained in human experiments because they are

directly taken from tissues using optimized

enzymatic digestion [22]. Recently, research-

ers generated human testicular organoids us-

ing rst-trimester human embryonic gonadal

cells in a three-layer gradient method. Hor-

mone production and dierentiation of Serto-

li and Leydig cells were examined after one

week of 3D culture [20].

The pool of testicular tissue within the SSCs

must be preserved. Apoptosis is a permanent

event in early development and the mature

testis. The SSCs pool in the testes must be

preserved.

Any defects in consecutive mitosis and mei-

osis divisions during spermatogenesis can

result in the progression of apoptosis and the

elimination of abnormal cells [23].

The death of testicular germ cells involves two

apoptotic pathways: the internal system, also

known as the mitochondrial mechanism, and

the extrinsic pathway, also known as the death

receptor [24]. Death receptors, including Fas

(CD95L), tumor necrosis factor (TNF), and

others, activate the initiator caspase 8 in the

extrinsic pathway. Bcl-2 catalyzes intrinsic

or mitochondrial reactions. Caspase 3 is ac-

Apoptosis Genes Expression in Human Testicular Organoids Nikmahzar A, et al.

GMJ.2023;12:e2805

www.gmj.ir

tivated by both internal and extrinsic caspase

activation, which increases the probability of

apoptosis [23, 25]. For the rst time, we in-

vestigated the apoptotic gene expression lev-

els in human testicular cells being cultured in

an organoid culture system. Also, the levels

of inhibin B and testosterone were analyzed

to assess the functioning of human testicular

organoids.

Materials and Methods

1. Sample Collection and Enzymatic Diges-

tion

Testicular tissues were donated by three brain-

dead donors from Sina Hospital, a part of Teh-

ran University of Medical Science. Consent

was obtained from the patients’ relatives by

the organ Procurement Unit of Sina Hospital

before utilizing the tests in this study. This

study was approved by the Ethics Committee

of the Tehran University of Medical Scienc-

es (IR.TUMS.VCR. REC.1398.450). For the

testicular cell isolation, a two-step enzymatic

digestion procedure was used according to the

Baert et al. protocol [26, 27]. After enzymatic

digestion, the cell suspensions were ltered

using a cell strainer with a 40 m mesh size to

obtain a suspension of single cells. Hemocy-

tometer was used for counting obtained cells,

and the viability rate was calculated using

0.04 percent Trypan blue (Sigma-Aldrich).

2. Culture and Proliferation of Human SSCs

The procedure was performed according to

the previous study on the propagation of hu-

man primary testicular cell [28]. The somat-

ic cells elimination was performed using the

dierential plating method. Floating cells

were then collected and cultured at a density

of 15000 to 20000 cells/cm

in 25 cm

asks

in DMEM/F12 containing 5% fetal bovine

serum (FBS; Gibco, Paisley, Uk), 10 ng/mL

glial cell line-derived neurotrophic factor

(GDNF; G1401, Sigma-Aldrich), and 10 ng/

mL broblast growth factor (bFGF; F3685,

Sigma-Aldrich), 10 ng/ml leukemia inhibitory

factor (LIF; L5283, Sigma Aldrich), and 5%

knock-out serum replacement (KSR; Invitro-

gen, USA). For 3 weeks asks were incubated

at 35°C and the culture media was changed

every two to three days. At the end of the 2D

culture period, the cells were trypsinized and

used for organoid culture and further analysis.

Trypsin-EDTA (0.25%) was utilized to tryp-

sinize the cultured cells and then used for or-

ganoid culture and further analysis.

3. Formation and Culture of Testicular Or-

ganoids

In this study, we performed a 3D organoid

culture system using the Pendergraft et al.

method [18]. Immediately following enzy-

matic digestion and 3 weeks of human SSC

2D culture, isolated cells were employed for

3D organoid culture. A 1:1 ratio of matrigel

(Matrigel; P/N 356231, Corning, Tewksbury,

MA, USA) and DMEM/F12 containing 10%

FBS was used to suspend the cells. A droplet

with a density of 10000 cells/20 μL was used

for the hanging drop culture technique. Or-

ganoids were transferred onto 24-well plates

containing DMEM/F12 supplemented by

10% FBS and 2.5 × 10

−5

IU recombinant fol-

licle-stimulating hormone (FSH, Sigma-Al-

drich), 100 ng/mL recombinant human stem

cell factor (SCF, Sigma-Aldrich. Louis, MO,

USA). After 2 days of incubation at 37 °C in

5% CO

, organoids were cultured in 3 groups:

Control group: 2D culture of human SSCs for

4 weeks.

Group 1: 2D culture of human SSCs and or-

ganoid culture for 4 weeks.

Group 2: organoid culture immediately after

enzymatic digestion for 4 weeks.

4. SSCs Conrmation Tests

4.1. RT-PCR Analysis

After enzymatic digestion, RT-PCR was used

to analyze the relative expression of VASA,

OCT4, PLZF (human germ cell-specic

genes), Sertoli and Leydig cell-specic genes

(Vimentin and CYP11A1).

Three replicates of each evaluation were per-

formed. Utilizing a qiazol reagent (Qiagen,

Hilden, Germany) and according to the rec-

ommended guidelines, total RNA was extract-

ed. spectrophotometry apparatus (Eppendorf,

Hamburg, Germany) was used to assess the

purity and agarose gel electrophoresis (1.5%

w/v agarose/TEA) was performed using the

protocol of Mushtaq et al. to analyze the in-

tegrity of the total RNA [29]. The genomic

GMJ.2023;12:e2805

www.gmj.ir

Nikmahzar A, et al. Apoptosis Genes Expression in Human Testicular Organoids

Table 1. The Designed Primers for RT-PCR and RT-qPCR Analyses

Gene Type and Sequences

Product

Size (bp)

Annealing

Temperature

(◦C)

1 PLZF

Forward:CGGGACTTTGTGCGATGTG

Reverse:

GCGGTGGAAGAGGATCTCAA

106 59

2 SYCP3

Forward :GGAAGGAGTTGGAGTTGACAT

Reverse :

ATCCCACTGCTGAAACAAAGTC

190 59

3 PRM2

Forward:ATGCTGCCGCCTGTGGAT

Reverse:GCCAAGAGGAGCAAGGGC

125 61

4 Oct4

Forward:CTGGGTTGATCCTCGGACCT

Reverse:

CACAGAACTCATACGGCGGG

128 60

5 Vimentin

Forward : CGTGAATACCAAGACCTGCTC

Reverse CTGCTCTCCTCGCCTTCC

89 59

6 CYP11A1

Forward : CTGCATCTTCAGTCGTCTGTCC

Reverse :

GGTGACCACTGAGAACCCATTC

83 61

7 BAX

Forward:GCGACTGATGTCCCTGTCTC

Reverse:AAAGATGGTCACGGTCTGCC

77 60

8 Bcl-2

Forward:TGGTGGGAGCTTGCATCAC

Reverse:GCATATTTGTTTGGGGCAGGC

77 62

9 VASA

Forward:ATCAACCCTCATCTGTCTTCC-

Reverse:TATTACACTCACCACCATCTCT

196 60

10 Caspase 9

F: GAGGACACAGGCCAGGACATG

R: CACTGGTCTGGGTGTTTCCGG

156 62

11 Caspase 3

F:CCGTGGTACAGAACTGGACTG

R: ACAAGAAGTCGGCCTCCACT

95 60

12 GAPDH

Forward:GCACCGTCAAGGCTGAGAAC

Reverse:ATGGTGGTGAAGACGCCAGT

142 61

GMJ.2023;12:e2805

www.gmj.ir

Apoptosis Genes Expression in Human Testicular Organoids Nikmahzar A, et al.

DNA contamination was eliminated using

DNase I (Fermentas, Waltham, MA, USA).

Complementary DNA (cDNA) was generated

using extracted RNA (1 g), random hexamers,

oligo (dT), and a cDNA synthesis kit (Fer-

mentas, Waltham, MA, USA).

Table-1 shows the primers utilized in the cur-

rent study. When the cDNA was synthesized,

PCR products were subjected to 1.5 percent

(w/v) agarose gel electrophoresis, and the UV

gel doc system was used to monitor the gels’

appearance.

4.2. SSCs Purity and Flow Cytometry Analya-

sis

For the calculation of the SSCs’ purity per-

centage, ow cytometry analysis was used.

Following the enzymatic digestion and 3

weeks 2D culture ow cytometric analysis

using a PLZF marker was accomplished by

applying standard procedures. Paraformalde-

hyde (PFA; Sigma-Aldrich) containing 4%

and 0.4% Triton X100 was used to x and per-

meabilize the primary testicular cells. Follow-

ing permeabilization, 15 μl of the anti-PLZF

primary antibody (anti-PLZF antibody, 1:100,

ab104854, Abcam, Cambridge, MA, USA)

with 10

cells were incubated overnight at

room temperature.

The cells were washed in PBS, and then at 4

°C anti-mouse FITC conjugated secondary

antibody (1:180; ab97022, Abcam, USA) was

added. A Beckman Coulter ow cytometer

(Partec AG, CH-4144 Arlesheim, Switzer-

land) equipped with a 15-mW argon-ion laser

and 488 nm excitation wavelength was used.

4.3. Immunocytochemistry Assay

Immunocytochemistry analyses were used to

identify the human Sertoli cells marker (Vi-

mentin) and SSCs specic markers (PLZF,

GFRα-1), following the 3 weeks of 2D cul-

ture. For this purpose, 4 % PFA (xation) and

0.5 % Triton X100 (permeabilization) were

added respectively. Five percent bovine serum

albumin (BSA; Sigma-Aldrich) was added to

inhibit the non-specic binding regions.

The xed cells were treated with anti-GFRα-1

(sc-28319, Santa Cruz Biotechnology, USA)

and anti-PLZF (sc-271546, Santa Cruz Bio-

technology, USA) primary antibodies at 1:100

concentrations and 37 °C for 2 h.and was vi-

sualized using DAPI (Sigma Aldrich) stain-

ing. The negative control has no primary an-

tibody. Fluorescence pictures were acquired

using a uorescence microscope (Olympus

BX51TRF, Tokyo, Japan) and a camera.

4.5. Quantitative PCR (q-PCR) Evaluation

In the experimental groups, after 24 hours and

4 weeks of culture, apoptotic gene expression

was assessed using qPCR and the compara-

tive CT approach. Total RNA extraction from

2D culture, performed using a qiazol (Qiagen,

Hilden, Germany) reagent, and in organoid

cultures was performed by the Da Silva et

al. protocol (30). PCR gene expression was

quantitatively assessed by an Applied Bio-

Systems (Applied BioSystems, Foster City,

USA) RT-qPCR equipment using the SYBR

Green Premix Ex Taq Kit (Tli RNaseH Plus).

As an internal control, the gene glyceralde-

hyde-3-phosphate dehydrogenase (GAPDH)

was chosen. Table-1 shows the primers used

to determine gene expression levels by qPCR.

All amplication reactions were carried out

in triplicate. The comparative CT method

(ΔΔCT) was used to assess the relative gene

expression.

4.6. Histological Analysis

After four weeks of cultivation, a morpholog-

ical analysis of human testis organoids was

performed using light microscopy. The human

testis organoids were xed in 4% PFA for 1

hour, dehydrated through increasing ethanol

concentrations, and xylene cleaning was fol-

lowed by paran embedding and sectioning

to a thickness of 5 μm. Toluidine blue staining

was used to stain the prepared sections and

histological analysis was carried out by light

microscopy (Olympus, Japan).

4.7. Statistical Analysis

For data analysis, SPSS software (version

16.0, Armonk, NY, USA) was used. All sta-

tistical analysis results were reported as mean

± standard deviation (SD). One-way analysis

of variance (ANOVA) and Tukey’s test were

used for apoptotic gene expression analysis,

and two-way ANOVA and Bonferroni post

hoc test were performed for hormone secre-

tion prole data analysis. P values of <0.05

were considered statistically signicant.

GMJ.2023;12:e2805

www.gmj.ir

Nikmahzar A, et al. Apoptosis Genes Expression in Human Testicular Organoids

Results

Evaluation of Human SSCs Viability

Trypan blue was utilized to measure the vitali-

ty of human cultured cells after enzymatic iso-

lation and after three weeks of culture. After

enzymatic digestion, the viability percentage

of freshly acquired human testicular cells was

more than 70%. The viability rate of obtained

human SSCs colonies increased above 88%

after 2D culture for three weeks. One week af-

ter the testicular cell suspension culture, small

colonies of SSCs appeared on the surface of

the Sertoli cells (Figure-1A), and SSC col-

onies proliferated and became larger after 3

weeks and became large (Figure-1B and 1C).

Human SSCs Colonies and Sertoli Cells Iden-

tication by Immunocytochemistry

GFRα-1 and PLZF proteins Expression as

markers of undierentiated SSCs was detect-

ed in obtained human SSCs colonies after 2D

culture of human testicular cells. Also, after

3 weeks of 2D culture, Sertoli cells express

the specic marker Vimentin according to the

immunocytochemistry results (Figure-2A-C).

Human SSCs Characterization by RT-PCR

The RT-PCR data showed the expression of

PLZF, VASA, OCT4 (human SSCs markers),

Vimentin (Sertoli cells marker), and CY-

P11A1 (Leydig cells marker) after enzymatic

digestion (Figure-2D).

Purication Percentage of Human SSCs by

Flow Cytometry Analysis

Flow cytometric analysis was performed after

enzymatic digestion and 3 weeks of 2D cul-

ture using a PLZF marker. Data showed that

after enzymatic digestion, 27.6% of testicular

cell suspension was possess the PLZF marker

(Figure-3A). The number of SSCs increased

signicantly after three weeks of 2D culture,

reaching 40.5 % (Figure-3B).

Morphological Assessment of Human Testic-

ular Organoids

Toluidine blue staining showed close mor-

phological similarity in groups 1 and 2. Hu-

man testicular organoids displayed a compact

structure after 4 weeks of culture. This com-

paction was pronounced in both groups at the

boundary of organoids; two to three layers of

compact cells were seen within the border of

organoids. Arrowheads indicate the elongated

cells (Figure-4).

Apoptosis-related Genes Expression in Hu-

man Testicular Organoids

The apoptosis gene expression in SSCs was

investigated by examining apoptosis genes,

including caspase 3, caspase 9, Bax, and Bcl-

2. Our ndings demonstrated that after 24

hours of culture, group 2 had greater expres-

sion levels of caspase 3, caspase 9, and Bax

than the other groups (P≤0.05). There was no

signicant dierence in caspase 3 and 9 rela-

tive expressions between group 1 and group

2 (P≥0.05). Data showed that after 24 hours

of culture, Bcl-2 (anti-apoptotic) expression

was higher in the control group compared to

experimental group 2 (P≤0.05). No signicant

dierence was found between test experi-

mental groups 1 and 2, as well as between the

control group and group 1. (P≥0.05). The rel-

ative expression level of pro-apoptotic genes

(caspase 3, 9, and Bax) after 4 weeks of cul-

ture was upregulated in group 1 and group 2

Figure 1. Human SSCs morphologies during 2D cultures. (A-B): After three weeks of culture, the arrow

indicated the Sertoli cells, and the arrowhead displayed the SSCs colonies. All scale bars=500μm.

GMJ.2023;12:e2805

www.gmj.ir

Apoptosis Genes Expression in Human Testicular Organoids Nikmahzar A, et al.

Figure 2. Immunocytochemistry and RT-PCR analyzes for SSCs characterization. (A-D): Double immu-

nostaining against GFR-α1, Vimentin, and PLZF in human SSCs 2D culture after 3 weeks. (A): GFR-α1

and Vimentin double immunostaining. (B): GFR-α1 and PLZF double immunostaining. (C): Negative con-

trol. All scale bars=20 μm. (D): RT-PCR images. The results for SSCs (VASA, OCT4, and PLZF), Sertoli

cells (Vimentin), and Leydig cells (CYP11A) detection at the RNA level, after enzymatic digestion. GAPDH

was used as the internal control.

Figure 3. Flow cytometry analyses for PLZF marker in primary testicular cells. A: Following two-step enzy-

matic isolation at day 0. B: After 3 weeks 2D culture.

GMJ.2023;12:e2805

www.gmj.ir

Nikmahzar A, et al. Apoptosis Genes Expression in Human Testicular Organoids

compared to the control (P≤0.05). Based on

the RT- qPCR ndings, the highest level of

Bcl-2 gene expression was observed in the

control (P≤0.05). In contrast, Groups 1 and

2 did not indicate any signicant dierence

(P≥0.05 , Figure-5).

Hormone Secretory Prole in Organoids

The presence of hormones (testosterone and

inhibin B) in the culture medium is essential to

demonstrate the functionality of human testic-

ular organoids. The presence of active Leydig

and Sertoli cells in organoids was conrmed

by the detection of testosterone and inhibin B,

respectively. The results showed that human

testicular organoids are functionally active

and they can secrete hormones. Testosterone

and inhibin B levels in culture supernatants

after 24 hours, two weeks, and four weeks of

culture showed that at 24h after organoid cul-

ture, testosterone concentration in group 1 had

the highest level compared to the other groups

(P ≤ 0.0001). The dierence between groups 1

and 2 was insignicant following 24 h of cul-

ture (P>0.05). We did not observe a signicant

dierence in testosterone levels between the

3 groups, after 4 weeks of culture. The con-

centration of inhibin B was higher in group 2

compared to group 1 and the control group,

also the dierence between groups 1 and 2

was remarkable (P<0.05). After two weeks of

culture, there was a signicant dierence in

the amount of inhibin B between group 2 and

other groups. Similar to testosterone, we did

not observe signicant dierences between

groups after 4 weeks of culture (Figure-6).

Our data showed that testosterone and inhibin

B levels were reduced during two weeks of

organoid culture compared to 24 hours of

culture in all three groups. This reduction in

hormone levels continues until the end of the

culture period (fourth week) (Figure-6). The

ndings demonstrate that despite the culture

medium containing the FSH, the hormone

secretion ability of adult human testicular or-

ganoids time-dependently decreased.

Discussion

In this study, we produced testicular organ-

oids from primary human testicular cells. The

morphology, hormone secretion proles, and

apoptotic gene expression were examined un-

der two dierent conditions: after 2D culture

and immediately after enzymatic digestion.

Cell arrangements and morphological charac-

teristics were similar in groups of human tes-

ticular organoids. The formation of spheroid

structures with elongated compact cells at the

boundaries was demonstrated. It was discov-

ered that pro-apoptotic gene levels increased

while Bcl-2, an anti-apoptotic gene, decreased

after 4 weeks of culture in the enzymatic di-

gestion group (group 2) compared to other

groups.

Concerning recent advances in human organ-

oid culture, drug ecacy assessment may

now be assessed in 3D primary cultures. Un-

Figure 4. Morphological assessment of testicular organoids after 4 weeks culture. All groups had similar

morphology and cell arrangement, with higher compaction in organoid edges. Arrowheads indicate the

elongated cells in border of organoids. (A-B): Toluidine blue staining of semi-thin sections for morphologi-

cal evaluation of testicular organoids. (A) group 1 , (B) group 2. Scale bars:100 μm.

Figure 5. Apoptosis genes qPCR results. (A): Expression rates of cas 3, cas 9, Bax and Bcl-2 after 24h.

(B): Expression rates of cas 3, cas 9, Bax and Bcl-2 after 4 weeks culturing in three groups. *: P>0.05; **:

P<0.005; ***: P<0.0005. Data are shown as means ± SD (n=3).

Apoptosis Genes Expression in Human Testicular Organoids Nikmahzar A, et al.

GMJ.2023;12:e2805

www.gmj.ir

fortunately, similar progress has not yet been

achieved in the testicular organoids. Testicu-

lar organoids are helpful approaches to assess

in vitro spermatogenesis, development, and

physiology of the human testis [31].

The apoptotic pathways (extrinsic and in-

trinsic) are active in the testicular cells. In

the mitochondrial or intrinsic pathway, Bax

is transferred from the cytoplasm to the mi-

tochondria. Cytochrome c is released into

the cytoplasm, stimulating programmed cell

death via apoptosis in this pathway. Members

of the Bcl-2 protein contribute to the intrinsic

pathway through its interaction with Bax [23].

The Fas ligand activates the Fas protein on the

cell membranes, activating the extrinsic path-

way, commonly known as the death receptor

mechanism [32].

It is well known that the intrinsic apoptosis

pathway regulates the population of testic-

ular germ cells. According to previous stud-

ies, failure to regulate apoptosis during the

rst phase of spermatogenesis resulted in in-

creased spermatogonial cells in mice lacking

the Bax gene [32, 33].

After 24 hours of culture, group 2 showed

higher levels of apoptotic gene expression

than the other groups. This increase resulted

in the enzymatic digestion of human testicular

tissue by collagenase and hyaluronidase. Ex-

pression of apoptotic genes decreased in group

1 using 2D culture after enzymatic digestion.

After four weeks of organoid culture, it was

found that the expression of pro-apoptotic

genes in group 2 was increased compared to

other groups, and the expression of anti-apop-

totic genes was decreased. It was observed

that group 2 had higher levels of pro-apoptotic

and lower rates of anti-apoptotic gene expres-

sion levels compared to the other groups.

Similar to our experimental results, in tes-

ticular tissue culture, Bax expression levels

increased while Bcl-2 expression levels de-

creased [34, 35]. Also, the previous study’s

ndings demonstrated that the percentage of

cells that undergoes apoptosis increased in

human testicular tissue culture. On the other

hand, selective germ cell apoptosis is neces-

sary for spermatogenesis [35].

Our results revealed that the concentration of

hormones decreased in the second week of the

existence of FSH in the culture media, and the

level of hormones decrease gradually during

the study. The physiological concentration of

gonadotropins did not aect the generation of

testosterone or Inhibin B. Presence of inhib-

in B and testosterone in the conditioning me-

dia suggested the functionality of Leydig and

Sertoli cells during the culture. In agreement

with our results, another study demonstrated

that the secretion of inhibin B and testosterone

was reduced in testicular organoids despite

the presence of gonadotropins in the culture

medium. The culture of mature testicular cells

leads to failure in stimulating gonadotropin

response [17].

The histological evaluations revealed that hu-

man primary testicular cells were structural-

ly transformed into spheroidal organoids. No

evidence of necrosis in testicular organoids

Figure 6. Testosterone and inhibin B secretory prole. Testosterone and inhibin B in the medium were

measured after 24 h, 2 weeks and 4 weeks of culturing. *: P<0.05; **: P<0.005; ***: P<0.0005. The data is

shown as means ± SDs (n=3).

Nikmahzar A, et al. Apoptosis Genes Expression in Human Testicular Organoids

GMJ.2023;12:e2805

www.gmj.ir

was observed by toluidine blue staining. Oval

or round-shaped cells were detected in the

central compartment of the organoids, while

spindle- or elongated broblast-like cells

were found in the outer part. According to our

results, spindle-shaped cells might be peritu-

bular myoid cells. Although, further investi-

gation is required to be done. Similar to our

research, the expression of the α-SMA marker

as the marker of myoid cells was reported in

elongated peritubular-like cells at the border

of human testicular cell clusters in the 2D cul-

ture of human testicular cells [36].

We created spheroid-shaped testicular organ-

oids using the hanging drop approach. The

interaction between surface tension and grav-

ity eld is the basis of the hanging-drop tech-

nique. Spheroid-shaped organoids help stimu-

late the cell to ECM interactions, resulting in

chemical and cellular gradients forming sim-

ilar to in vivo conditions [37]. According to

the previous experiment, the advantage of the

hanging drop technique is the ability to easi-

ly manipulate testicular organoids and control

the size and organization of cells [18].

Testicular organoids could provide insight

into the processes that explain normal sper-

matogenesis and underlying diseases. The 3D

culture systems that are currently available

are only appropriate for quick assessments

[38]. The missing piece in the treatment of

non-obstructive azoospermia and male fertili-

ty preservation in the clinic is a technique that

permits in vitro spermatogenesis [39].

Conclusion

Generation of organoids from primary human

testicular cells in a 3D microenvironment is a

novel approach that enables cell-cell interac-

tions, cell polarization, ECM production, and

cell-specic gene expression. Spherical tes-

ticular organoids are easy to manipulate and

investigate. Also, the functioning of Leydig

and Sertoli cells could be maintained in the

testicular organoids. Testicular organoids can

be suggested for in vitro normal spermatogen-

esis, drug toxicity research, and future clinical

applications.

Acknowledgments

A grant (98-02-30-42456) from the Tehran

University of Medical Sciences supported this

research. The ndings of this paper were in-

cluded in a Ph.D. thesis.

Conict of Interest

The authors declare that they have no conict

of interest.

References

Tames DR, Amaral NL, Amaral VL. Wistar

rats immature testicular tissue vitrication

and heterotopic grafting. JBRA Assisted

Reproduction. 2018 Jul;22(3):167.

6. Kanbar M, de Michele F, Wyns C.

Cryostorage of testicular tissue and

retransplantation of spermatogonial stem

cells in the infertile male. Best Practice

& Research Clinical Endocrinology &

Metabolism. 2019;33(1):103-15.

7. Oblette A, Rondeaux J, Dumont L,

Delessard M, Saulnier J, Rives A, et

al. DNA methylation and histone post-

translational modications in the mouse

germline following in-vitro maturation of

fresh or cryopreserved prepubertal testicular

tissue. Reproductive BioMedicine Online.

2019;39(3):383-401.

8. Sun M, Yuan Q, Niu M, Wang H, Wen L, Yao

C, et al. Ecient generation of functional

1. Brignardello E, Felicetti F, Castiglione A,

Nervo A, Biasin E, Ciccone G, et al. Gonadal

status in long-term male survivors of

childhood cancer. Journal of Cancer Research

and Clinical Oncology. 2016;142(5):1127-32.

2. Wyns C, Curaba M, Vanabelle B, Van

Langendonckt A, Donnez J. Options for

fertility preservation in prepubertal boys.

Hum Reprod Update. 2010;16(3):312-28.

3. Goossens E, Van Saen D, Tournaye H.

Spermatogonial stem cell preservation and

transplantation: from research to clinic. Hum

Reprod. 2013;28(4):897-907.

4. Valli-Pulaski H, Peters KA, Gassei K,

Steimer SR, Sukhwani M, Hermann BP,

et al. Testicular tissue cryopreservation:

8 years of experience from a coordinated

network of academic centers. Hum Reprod.

2019;34(6):966-77.

5. Benvenutti L, Salvador RA, Til D, Senn AP,

apoptosis genes expression in human testicular organoids Nikmahzar A, et al.Apoptosis Genes Expression in Human Testicular Organoids Nikmahzar A, et al.

GMJ.2023;12:e2805

www.gmj.ir

haploid spermatids from human germline

stem cells by three-dimensional-induced

system. Cell Death & Dierentiation.

2018;25(4):749-66.

9. Alves-Lopes JP, Stukenborg J-B. Testicular

organoids: a new model to study the

testicular microenvironment in vitro? Human

Reproduction Update. 2018;24(2):176-91.

10. Bode KJ, Mueller S, Schweinlin M, Metzger

M, Brunner T. A fast and simple uorometric

method to detect cell death in 3D intestinal

organoids. BioTechniques. 2019;67(1):23-8.

11. Bredenoord AL, Clevers H, Knoblich JA.

Human tissues in a dish: the research and

ethical implications of organoid technology.

Science. 2017 Jan 20;355(6322):eaaf9414.

12. Drost J, van Jaarsveld RH, Ponsioen B,

Zimberlin C, van Boxtel R, Buijs A, et al.

Sequential cancer mutations in cultured

human intestinal stem cells. Nature.

2015;521(7550):43-7.

13. Lancaster MA, Renner M, Martin C-A,

Wenzel D, Bicknell LS, Hurles ME, et al.

Cerebral organoids model human brain

development and microcephaly. Nature.

2013;501(7467):373-9.

14. Takebe T, Sekine K, Enomura M, Koike

H, Kimura M, Ogaeri T, et al. Vascularized

and functional human liver from an iPSC-

derived organ bud transplant. Nature.

2013;499(7459):481-4.

15. Drost J, Karthaus WR, Gao D, Driehuis E,

Sawyers CL, Chen Y, et al. Organoid culture

systems for prostate epithelial and cancer

tissue. Nature Protocols. 2016;11(2):347-58.

16. Chua CW, Shibata M, Lei M, Toivanen R,

Barlow LJ, Bergren Sarah K, et al. Single

luminal epithelial progenitors can generate

prostate organoids in culture. Nature Cell

Biology. 2014;16(10):951-61.

17. Baert Y, De Kock J, Alves-Lopes JP, Söder

O, Stukenborg J-B, Goossens E. Primary

Human Testicular Cells Self-Organize into

Organoids with Testicular Properties. Stem

Cell Reports. 2017;8(1):30-8.

18. Pendergraft SS, Sadri-Ardekani H, Atala A,

Bishop CE. Three-dimensional testicular

organoid: a novel tool for the study of

human spermatogenesis and gonadotoxicity

in vitro†. Biology of Reproduction.

2017;96(3):720-32.

19. Alves-Lopes JP, Söder O, Stukenborg

J-B. Testicular organoid generation by a

novel in vitro three-layer gradient system.

Biomaterials. 2017;130:76-89.

20. Oliver E, Alves-Lopes JP, Harteveld

F, Mitchell RT, Åkesson E, Söder O,

Stukenborg JB. Self-organising human

gonads generated by a Matrigel-based

gradient system. BMC biology. 2021

Dec;19:1-1.

21. Cham TC, Ibtisham F, Fayaz MA,

Honaramooz A. Generation of a highly

biomimetic organoid, including vasculature,

resembling the native immature testis tissue.

Cells. 2021 Jul 5;10(7):1696.

22. Astashkina AI, Mann BK, Prestwich GD,

Grainger DW. Comparing predictive drug

nephrotoxicity biomarkers in kidney 3-D

primary organoid culture and immortalized

cell lines. Biomaterials. 2012;33(18):4712-

21.

23. Shaha C, Tripathi R, Mishra DP. Male

germ cell apoptosis: regulation and

biology. Philosophical Transactions of

the Royal Society B: Biological Sciences.

2010;365(1546):1501-15.

24. Aitken RJ, Findlay JK, Hutt KJ, Kerr JB.

Apoptosis in the germ line. Reproduction.

2011;141(2):139-50.

25. Cory S, Adams JM. The Bcl2 family:

regulators of the cellular life-or-death switch.

Nat Rev Cancer. 2002;2(9):647-56.

26. Baert Y, Rombaut C, Goossens E. Scaold-

based and scaold-free testicular organoids

from primary human testicular cells.

Organoids: Stem Cells, Structure, and

Function. 2019:283-90.

27. Koruji M, Shahverdi A, Janan A, Piryaei

A, Lakpour MR, Gilani Sedighi MA.

Proliferation of small number of human

spermatogonial stem cells obtained from

azoospermic patients. J Assist Reprod Genet.

2012;29(9):957-67.

28. Sadri-Ardekani H, Mizrak SC, van Daalen

SK, Korver CM, Roepers-Gajadien HL,

Koruji M, et al. Propagation of human

spermatogonial stem cells in vitro. Jama.

2009;302(19):2127-34.

29. Mushtaq S, Tayyeb A, Firdaus e B. A

comparison of total RNA extraction methods

for RT-PCR based dierential expression of

genes from Trichoderma atrobrunneum. J

Microbiol Methods. 2022;200:106535.

30. Da Silva L, Bray JK, Bulut G, Jiang J,

Schmittgen TD. Method for improved

integrity of RNA isolated from Matrigel

cultures. MethodsX. 2020;7:100966.

31. Sakib S, Voigt A, Goldsmith T, Dobrinski

I, Skinner M. Three-dimensional testicular

organoids as novel in vitro models of

testicular biology and toxicology. Environ

Nikmahzar A, et al. Apoptosis Genes Expression in Human Testicular Organoids

GMJ.2023;12:e2805

www.gmj.ir

Epigenet. 2019;5(3):dvz011.

32. Sinha Hikim AP, Lue Y, Diaz-Romero M,

Yen PH, Wang C, Swerdlo RS. Deciphering

the pathways of germ cell apoptosis in

the testis. J Steroid Biochem Mol Biol.

2003;85(2-5):175-82.

33. Koji T. Male germ cell death in mouse testes:

possible involvement of Fas and Fas ligand.

Med Electron Microsc. 2001;34(4):213-22.

34. Hajiaghalou S, Ebrahimi B, Shahverdi

A, Sharbatoghli M, Beigi Boroujeni N.

Comparison of apoptosis pathway following

the use of two protocols for vitrication

of immature mouse testicular tissue.

Theriogenology. 2016;86(8):2073-82.

35. Roulet V, Denis H, Staub C, Le Tortorec

A, Delaleu B, Satie AP, et al. Human testis

in organotypic culture: application for

basic or clinical research. Hum Reprod.

2006;21(6):1564-75.

36. Von Kopylow K, Schulze W, Salzbrunn

A, Schaks M, Schäfer E, Roth B, et al.

Dynamics, ultrastructure and gene expression

of human in vitro organized testis cells from

testicular sperm extraction biopsies. Mol

Hum Reprod. 2018;24(3):123-34.

37. Hinderberger D, Langan LM, Dodd NJF,

Owen SF, Purcell WM, Jackson SK, et al.

Direct Measurements of Oxygen Gradients

in Spheroid Culture System Using Electron

Parametric Resonance Oximetry. Plos One.

2016;11(2):e0149492.

38. Jørgensen A, Nielsen JE, Perlman S,

Lundvall L, Mitchell RT, Juul A, et al.

Ex vivo culture of human fetal gonads:

manipulation of meiosis signalling

by retinoic acid treatment disrupts

testis development. Hum Reprod.

2015;30(10):2351-63.

39. Gassei K, Orwig KE. Experimental methods

to preserve male fertility and treat male factor

infertility. Fertil Steril. 2016;105(2):256-66.

Apoptosis Genes Expression in Human Testicular Organoids Nikmahzar A, et al.

GMJ.2023;12:e2805