Cytotoxic and Apoptotic Eects of Vanadyl Sulfate
on MCF-7 Breast Cancer Cell Line
Maryam Dehdashti1, Zahra Abbasy2, Hamid Zaferani Arani3, Hesam Adin Atashi1, Seyed Alireza Salimi-Tabatabaee4,
Afsaneh Ghasemi5, Zhila Fereidouni6, Hadi Zare Marzouni7, Habib Zakeri8, Seyed Abbas Mirmalek9
1 Young Researchers and Elite Club, Tehran Medical Sciences, Islamic Azad University, Tehran, Iran
2 Faculty of Medicine, Kashan University of Medical Sciences, Kashan, Iran
3 Department of Surgery, Shariati Hospital. Tehran University of Medical Sciences, Tehran, Iran
4 Department of Surgery, Kashan University of Medical Sciences, Kashan, Iran
5 Department of Public Health, School of Health, Fasa University of Medical Sciences, Fasa, Iran
6 Department of Nursing, School of Nursing, Fasa University of Medical Sciences, Fasa, Iran
7 Qaen School of Nursing and Midwifery, Birjand University of Medical Sciences, Birjand, Iran
8 Research Center for Neuromodulation and Pain, NAB Pain Clinic, Shiraz University of Medical Sciences, Shiraz, Iran
9 Department of Surgery, Tehran Medical Sciences, Islamic Azad University, Tehran, Iran
GMJ.2023;12:e3050
www.gmj.ir
Correspondence to:
Seyed Abbas Mirmalek, Department of Surgery, Facul-
ty of Medicine, Tehran Medical Sciences, Islamic Azad
University, Tehran, Iran.
Telephone Number: +98-2122006660-7
Email Address: sam@mirmalek.net
Received 2023-05-08
Revised 2023-06-01
Accepted 2023-06-21
Abstract
Background: Breast cancer (BC) is the major cause of cancer-related death in women. Some
studies have indicated the cytotoxic eects of vanadyl oxide sulfate (VOSO4). This study
aimed to evaluate the anti-cancer eect of VOSO4 in the treatment of MCF-7 cell lines.
Materials and Methods: The MCF-7 cell line was treated with dierent concentrations of
VOSO4 for 24 and 48 hours. Cell death was measured using the MTT assay. The cell apop-
tosis rate was measured using Annexin V/Propidium Iodide assay through ow cytometry.
Also, the expression levels of p53, P21, Caspase8, superoxide dismutase type 1 (SOD1),
Sod2, and Bcl2 mRNAs were assessed, and Western blotting was performed for Sod1 protein.
Results: The results showed that the half-maximal inhibitory concentration (IC50) for VOSO4
was 25 and 20 μg/ml for 24 and 48 hours, respectively. Indeed, VOSO4 has dose-dependent cyto-
toxic eects on the MCF-7. Also, after exposure to VOSO4 for 24 hours, cell apoptosis reached
52% compared with untreated cells. Moreover, after 24 hours of exposure to VOSO4 with IC50
concentration, the expression of p53, P21, Caspase8, Sod1, and Sod2 mRNAs increased (P<0.05),
and the expression of Bcl2 mRNA was decreased (P<0.05). Also, the Western blotting revealed
Sod1 protein level markedly increased following exposure to VOSO4 (P<0.05). Conclusion:
Our results demonstrated that VOSO4 has an apoptotic and cytotoxic eect on BC cells. There-
fore, it could be considered a complementary agent for the medical treatment of patients with BC.
[GMJ.2023;12:e3050] DOI:10.31661/gmj.v12i0.3050
Keywords: Vanadyl Sulfate; Breast Cancer; Anti-cancer; MCF-7; Apoptosis; Anti-oxidative
GMJ
Copyright© 2021, Galen Medical Journal.
This is an open-access article distributed
under the terms of the Creative Commons
Attribution 4.0 International License
(http://creativecommons.org/licenses/by/4.0/)
Email:info@gmj.ir
Introduction
Breast cancer (BC) is a multifactorial dis-
ease aected by genetic and environmen-
tal factors.
It is the most common type of cancer among
women after non-melanoma skin cancer [1,
2] and the second cause of death from cancer
in women after lung cancer [1-3]. Currently,
treatment options include surgery, radiothera-
py, chemotherapy, gene therapy, and so forth.
[4, 5]. In general, many chemical drugs used
Dehdashti M, et al. Eect of VOSO4 on MCF-7 Cells
2GMJ.2023;12:e3050
www.gmj.ir
in chemotherapy often cause changes in the
cell division process, inhibiting the prolifer-
ation and dierentiation of malignant cells
[4-6].
Although cytotoxic properties against can-
cer cells are important in synthesizing these
drugs, low side eects on healthy cells are
critical issues [4, 6].
In recent years, much attention has been paid
to the search for new anti-cancer compounds
containing metallic ions. Iron was the rst
metal compound used in drug chemistry [7].
Adopting metal complexes as the drug was
developed by applying complexes of plati-
num, including cisplatin [7-11].
Metal components–binding to the cytotoxic
agents–could eectively deliver the medica-
tions to the surgery site [8, 9]. Indeed, med-
ications with ligands containing manganese,
cobalt, and copper have been prepared, bind-
ing these complexes to DNA and causing its
breakdown [11-13].
Evidence reveals that vanadium and its sev-
eral chemical compounds have important bi-
ological activities [12, 14, 15]. Vanadium at
very low concentrations has anti-cancer prop-
erties without signicant toxicity [8].
Indeed, previous in-vivo and in-vitro stud-
ies showed that vanadium compounds have
both inhibitory and anti-tumor eects against
chemical agent-induced cancers [10, 13].
Hence, it may induce cell cycle arrest, DNA
fragmentation, and lipoperoxidation of the
plasma membrane [11, 13]. Anti-cancer ef-
fects of vanadium were examined in a study
on rat BC models [12].
Subsequent studies have shown the eec-
tiveness of vanadium compounds on various
types of human malignancies, including liver,
breast, hematopoietic, renal, and epithelial tu-
mors [11-13].
Previous studies suggested that dierent
mechanisms for the anti-tumor eects of va-
nadium through its eect on important cellular
processes, such as some metabolic pathways,
lead to a reduction or an increase in the ex-
pression of various proteins [8, 9, 11, 16-19].
However, the eects of vanadium on BC and
its mechanisms are examined in a few studies.
Therefore, this study aimed to evaluate the
anti-tumor eects of vanadyl oxide sulfate
(VOSO4) on the MCF-7 cell line.
Materials and Methods
Cell Culture and Groups
The MCF-7 cell line (Pasteur Institute, Teh-
ran, Iran) was cultured in a complete medium
containing high glucose Dulbecco’s Modied
Eagle Medium (Gibco, USA) with 10% fetal
bovine serum (Gibco, USA) plus 100 mg/ml
streptomycin (Gibco, USA) and 100 U/ml
penicillin (Gibco, USA). The medium was
exchanged two times a week before the ad-
dition of fresh media cells and washed with
phosphate-buered saline (Gibco, USA).
Also, the MCF-7 cells were divided into the
VOSO4 group, which was treated with the
half-maximal inhibitory concentration (IC50)
dose of VOSO4 (Sigma, USA) for 24 hours
and control group (MCF-7 cells without any
treatment).
Determining IC50 Dose
The ICD50 dose of VOSO4 was assessed
using 3-[4, 5-dimethylthiazol-2-yl]-2, 5 di-
phenyl tetrazolium bromide (MTT) assay kit
(Sigma, USA). In brief, 8000 and 6000 cells
were seeded into each well of 96-well plates
16 hours before VOSO4 treatment for 24 and
48 hours, respectively. After 24 and 48 hours,
each well was replaced with fresh medium,
and MTT powder was added to them accord-
ing to the manufacturer’s instructions. After
four hours, purple formazan sediments ap-
peared at the bottom of each well. These crys-
tals were then dissolved in 200 µl of dimethyl
sulfoxide (Sigma, USA), and the absorption
of each well was determined by the Biotek
ELX800 microplate reader (Bio-Tek, Instru-
ments, Vermont, USA). Also, the Annexin V/
PI kit (Roche, Germany) was employed to
examine the type of cellular death after treat-
ment as described in the kit manual.
Real-time Polymerase Chain Reaction (PCR)
Total RNA from VOSO4 and control group
samples was extracted with TRIzol (Invitro-
gen, Carlsbad, USA). The same amount of
mRNA was used for cDNA synthesis using
a cDNA synthesis kit (Takara, Japan). These
cDNAs were then used as the template for
real-time PCR, which was performed using
the Rotor-Gene Q 5plex (Qiagen, Germany)
as follows: holding stage (95°C for ve min-
Eect of VOSO4 on MCF-7 Cells Dehdashti M, et al.
GMJ.2023;12:e3050
www.gmj.ir
3
utes), cycling stage (including denaturing step
[95°C for 15 seconds], followed by annealing
[60°C for 30 seconds], amplication [72°C
for 20 seconds, and 40 cycles], and melt curve
stage). Primers were designed to specically
amplify cDNA from mRNAs of P53, P21,
Caspase8, Bcl2, superoxide dismutase type 1
(SOD1), and Sod2 genes (Table-1).
Western Blot
Cells were lysed, total protein was extracted,
and equal amounts of protein from each treat-
ed or untreated sample were utilized for SDS-
PAGE (10% sodium dodecyl sulfate-poly-
acrylamide gel electrophoresis). Subsequent-
ly, cells were transferred to the nitrocellulose
membrane. A 5% non-fat milk incubation for
one hour at room temperature was employed
for blocking. The membrane was then incu-
bated with the primary antibody (Abcam, UK)
against Sod1 protein overnight at 4°C. After
that, the membrane was washed three times
with a washing buer containing TBS plus
Tween 20 (Gibco, USA). Goat Anti-Rabbit
IgG H&L (Abcam, UK) was used as the sec-
ondary antibody (mouse monoclonal antibody
against glyceraldehyde-3-phosphate dehydro-
genase [GAPDH] protein was utilized as the
control). The immunocomplexes were visu-
alized with an Immobilon Western Chemilu-
minescent HRP substrate (Millipore, USA),
and appeared bonds were further analyzed by
Image J software (version 1.41 National In-
stitutes of Health, Bethesda, USA) for quan-
tication.
Statistical Analysis
All tests were repeated three times. The re-
sults were expressed as mean ± standard devi-
ation. Data were analyzed by GraphPad Prism
software (version 6.01, GraphPad, La Jolla,
CA) using ANOVA and Bonferroni’s tests.
The signicant dierence was set at P<0.05.
Results
The IC50 Dose of VOSO4
Regarding the MTT assay, 25 and 20 μg/ml
of VOSO4 could induce about 50% cellular
death after 24 and 48 hours in MCF-7 cells
(P˂0.05, Figure-1). Also, Annexin V/PI ow
cytometry demonstrated that after treating
MCF-7 cells with 25 μg/ml of VOSO4 for 24
hours, 52% of cells underwent apoptosis com-
pared to the control group (P˂0.05, Figure-2).
Table 1. Sequences of Primers and Amplication Reactions Conditions for Evaluation of the Relative
Expression
Genes Primers sequences (5’-3’) Amplicon (bp)
P53 F: GGTACCGTATGAGCCACCTG
R: AACCTCAAAGCTGTCCCGTC 166
P21 F: ACTCTCAGGGTCGAAAACGG
R: GATGTAGAGCGGGCCTTTGA 150
Bcl2 F: TCTTTGAGTTCGGTGGGGTC
R: GTTCCACAAAGGCATCCCAG 153
Sod1 F: ACAAAGATGGTGTGGCCGAT
R: AACGACTTCCAGCGTTTCCT 162
Sod2 F: GGTCTGCATTATGCTTGCATGT
R: GACTGGAGATACAGGTCTTGGTC 141
Caspase8 F: AGCAGCCTATGCCACCTAGT
R: GCTGTAACCTGTCGCCGAG 261
GAPDH F: AAGTTCAACGGCACAGTCAAGG
R: CATACTCAGCACCAGCATCACC 121
Sod1: Superoxide dismutase type 1 (SOD1); GAPDH: Glyceraldehyde-3-phosphate dehydrogenase
4GMJ.2023;12:e3050
www.gmj.ir
Dehdashti M, et al. Eect of VOSO4 on MCF-7 Cells
Treatment with VOSO4 Could Upregulated
Apoptotic Genes
As depicted in Figure-3, the expression lev-
el of apoptotic genes, including P53, P21,
Caspase8, Sod1, and Sod2 were signicantly
increased after VOSO4 treatment compared
with the control group (P˂0.05). However, the
Bcl2 mRNA expression markedly declined in
treated cells as an anti-apoptotic gene (Fig-
ure-3).
Apoptotic Eect of VOSO4 Could Induced Via
Anti-Oxidative Properties
Western blot data revealed that the Sod1 pro-
tein level was signicantly increased after the
treatment of MCF-7 cells with 25 μg/ml of
VOSO4 for 24 hours (P˂0.05, Figure-4). In-
deed, administered IC50 dose VOSO4 for 24
hours could elevate Sod1 level two-fold com-
pared with untreated control cells.
Discussion
The present study demonstrated that VOSO4
could signicantly induce apoptosis in MCF-
7 cells via upregulation of apoptotic genes, in-
cluding P53, P21, and Caspase8, and down-
regulates Bcl2–important anti-apoptotic gene–
as compared to untreated cells. Also, Western
blotting analysis revealed overexpression of
Figure 1. MTT assay results revealed that treatment of MCF-7 cells with 25µg/ml of VOSO4 induces 50%
cellular death after 24 hours (A); furthermore, treatment of these cells with 20µg/ml of VOSO4 induces
50% cellular death after 48 hours (B). *P˂0.05 vs. untreated cell
Figure 2 . Annexin V/PI test conrmed that apoptosis was observed in the MCF-7 cells after treatment of
these cells with the IC50 dose of VOSO4 for 24 hours. This treatment induces 52% apoptosis (A) in MCF-
7 cells compared to the untreated cells as a control (B).
GMJ.2023;12:e3050
www.gmj.ir
5
Eect of VOSO4 on MCF-7 Cells Dehdashti M, et al.
Sod1, which is the essential protein in the
anti-oxidative pathway. Indeed, it seems that
VOSO4 could exert its apoptotic eect via the
anti-oxidative pathway. Previous studies indi-
cated that the vanadium induced apoptosis in
lymphocytes owing to mitochondrial damage
and change in the rate of apoptotic proteins
(i.e., Bcl2, Bax, and Caspase-3) [20, 21]. Va-
nadium aects various biochemical processes
and interacts with many enzymes, including
protein kinase, phosphatase, ATPase, perox-
idase, ribonuclease, and oxidoreductase [22,
23].
A study by Ray et al. [24] indicated that one
of the vanadium compounds (NH4VO3) had
no signicant toxicity on the normal healthy
mammary MCF-7 cell line as a control [24].
In addition, Kordowiak et al. showed that the
cytotoxic eects of VOSO4 on control cells
were signicantly less than other vanadium
compounds [11]. These ndings may indicate
that VOSO4 does not have a signicant cy-
totoxicity eect on normal cells. However,
its presence in cancer cells could result in the
modied expression of p53 and Bax and the
regulation of Bcl2 protein as well as anticoag-
ulant activity [25-27].
Several studies demonstrated the anti-cancer
eects of vanadium in both in-vitro and in-vi-
vo experiments [25, 26, 28, 29]. However, the
mechanism of VOSO4 in cancer cell therapy
is still not clearly understood. It is argued that
this substance in several cellular pathways
can aect cell survival and death.
Our results indicated that VOSO4 had signi-
cant cytotoxic eects on MCF-7 cancer cells.
On the other hand, our results showed an in-
crease in the expression of the genes inducing
cell programmed death (p53, p21, Caspase8,
Sod1, and Sod2) and a reduction in cell sur-
vival (Bcl2) gene.
Das et al. [20] showed that vanadium inhibit-
ed the growth of cancer cells. Indeed, the an-
ti-tumor potential of vanadium was reported
in the liver, colon, and intestine cancers in-vi-
vo studies and the dierent cancerous epithe-
lial cells of the in-vitro model [20]. Also, they
showed that vanadium could play a major role
in moderating the phosphorylation states of
various proteins in the cell and aecting many
adenosine mono-phosphate cyclic-regulated
cellular processes [20].
In a study conducted by Holko et al. [9], the
eect of VOSO4 on the growth of human can-
cer epithelial cells of exocrine tissue was ex-
amined. The results showed that VOSO4 sig-
Figure 3. The relative expression of mRNAs for important genes involved in the apoptosis and oxidation
pathways. Treatment of MCF-7 cells with the IC50 dose of VOSO4 for 24 hours leads to upregulate the
expression of P53 (A), P21 (B), and Caspase8 (C), and downregulates Bcl2 (D), important genes in apop-
tosis pathway); moreover, this treatment upregulates important genes in oxidation pathway including Sod1
(E) and Sod2 (F). *P˂0.05, **P˂0.01, ***P˂0.001 vs. control
6GMJ.2023;12:e3050
www.gmj.ir
Dehdashti M, et al. Eect of VOSO4 on MCF-7 Cells
References
nicantly inhibited cell growth and reduced
carcinoma cells. It also increased the ratio of
apoptotic and necrosis cells compared with
the control group [9]. However, it should be
noted that VOSO4 signicantly reduces the
vital capability of human cells (BEAS-2B and
PNT-2) [9].
Moreover, according to Kordowiak et al. [11],
electron microscopic examinations showed
that vanadium salts at low concentrations (0.5
μM) destructed cell morphology. Also, higher
doses of vanadium salts (more than 2.5-5 μM)
damage the cytotoxic state of cellular organ-
elles [11].
In their research, they found that vanadium
aects various biochemical processes and can
interact with many enzymes [11]. These re-
sults and similar studies suggest that VOSO4
induces apoptosis by increasing the expres-
sion of genes inducing cell death and prevent-
ing cell division by expressing cell survival
genes. However, the mechanism of its action
on cancer cells is still unknown.
Conclusion
Our results suggest that VOSO4 was a cyto-
toxic agent inducing cell death through the ex-
pression of apoptosis-inducing genes in MCF-
7 cells. It seems that this substance could be
considered an appropriate alternative for
treating BC with its proper anti-cancer eects.
Acknowledgments
All authors thank Dr. Mohammad Amin Javi-
di for providing technical support. Also, we
are thankful to the EMA24 English editing
service for improving the language of this ar-
ticle.
Conict of Interest
All authors declare no conict of interest.
Figure 4. A: Western blot data conrmed that Sod 1 protein level was increased after the treatment of
MCF-7 cells with the IC50 dose of VOSO4 for 24 hours. B: Quantication of Western blot data (normalized
with β-actin protein) revealed that this treatment increased Sod 1 protein expression level about 2-fold
compared with untreated control cells. * P˂0.05 vs. control
1. Marzouni HZ, Lavasani Z, Shalilian M,
Najibpour R, Fakhr MS, Nazarzadeh R, et al.
Women's Awareness and Attitude Toward Breast
Self-Examination in Dezful City, Iran, 2013. Iran
Red Crescent Med J. 2015;17(1):e17829.
2. Gamasaee NA, Radmansouri M, Ghiasvand
S, Shahriari F, Marzouni HZ, Aryan H, et al.
Hypericin Induces Apoptosis in MDA-MB-175-
VII Cells in Lower Dose Compared to MDA-
MB-231. Arch Iran Med. 2018;21(9):387-92.
3. Mirmalek SA, Jangholi E, Jafari M, Yadol-
lah-Damavandi S, Javidi MA, Parsa Y, et
al. Comparison of in Vitro Cytotoxicity and
Apoptogenic Activity of Magnesium Chloride
and Cisplatin as Conventional Chemotherapeu-
tic Agents in the MCF-7 Cell Line. Asian Pac J
Cancer Prev. 2016;17(S3):131-4.
4. Mirmalek SA, Azizi MA, Jangholi E, Yadol-
lah-Damavandi S, Javidi MA, Parsa Y, et al.
Cytotoxic and apoptogenic eect of hypericin,
the bioactive component of Hypericum perfora-
tum on the MCF-7 human breast cancer cell line.
GMJ.2023;12:e3050
www.gmj.ir
7
Eect of VOSO4 on MCF-7 Cells Dehdashti M, et al.
Cancer Cell Int. 2016;16(1):3.
5. Marzouni HZ, Bagherabad MB, Sharaf S,
Zarrinkamar M, Shaban S, Aryan H, et al.
Thioredoxin Reductase Activity and Its Tissue
Distribution in the Pathologic Specimens of
Patients with Laryngeal Squamous Cell Carcino-
ma. Galen Med J. 2016;5(3):153-59.
6. Mirmalek S, Faraji S, Ranjbaran S, Aryan H,
Arani H, Jangholi E, et al. Cyanidin 3-glycoside
induced apoptosis in MCF-7 breast cancer cell
line. Arch Med Res. 2020;16(1):1098-1192.
7. Abakumova O, Podobed OV, Beliaeva NF,
Tochilkin AI. Anticancer activity of oxovanadi-
um compounds. Biomed Khim. 2013;59(3):305-
20.
8. Dabros W, Adamczyk A, Ciurkot K, Kordowiak
AM. Vanadium compounds aect growth and
morphology of human rhabdomyosarcoma cell
line. Pol J Pathol. 2011;62(4):262-8.
9. Holko P, Ligeza J, Kisielewska J, Kordowiak
AM, Klein A. The eect of vanadyl sulphate
(VOSO4) on autocrine growth of human epithe-
lial cancer cell lines. Pol J Pathol. 2008;59(1):3-
8.
10. Kim AD, Zhang R, Kang KA, You HJ, Kang
KG, Hyun JW. Jeju ground water containing va-
nadium enhances antioxidant systems in human
liver cells. Biol Trace Elem Res. 2012;147(1-
3):16-24.
11. Kordowiak AM, Klein A, Goc A, Dabros W.
Comparison of the eect of VOSO4, Na3VO4
and NaVO3 on proliferation, viability and mor-
phology of H35-19 rat hepatoma cell line. Pol J
Pathol. 2007;58(1):51-7.
12. Thompson HJ, Chasteen ND, Meeker LD. Di-
etary vanadyl(IV) sulfate inhibits chemically-in-
duced mammary carcinogenesis. Carcinogenesis.
1984;5(6):849-51.
13. Wozniak K, Blasiak J. Vanadyl sulfate can dif-
ferentially damage DNA in human lymphocytes
and HeLa cells. Arch Toxicol. 2004;78(1):7-15.
14. Hanauske U, Hanauske AR, Marshall MH,
Muggia VA, Von Ho DD. Biphasic eect of
vanadium salts on in vitro tumor colony growth.
Int J Cell Cloning. 1987;5(2):170-8.
15. Liasko R, Kabanos TA, Karkabounas S,
Malamas M, Tasiopoulos AJ, Stefanou D, et al.
Benecial eects of a vanadium complex with
cysteine, administered at low doses on benzo(al-
pha)pyrene-induced leiomyosarcomas in Wistar
rats. Anticancer res. 1998;18(5a):3609-13.
16. Sabbioni E, Pozzi G, Devos S, Pintar A, Casella
L, Fischbach M. The intensity of vanadi-
um(V)-induced cytotoxicity and morphological
transformation in BALB/3T3 cells is dependent
on glutathione-mediated bioreduction to vanadi-
um(IV). Carcinogenesis. 1993;14(12):2565-8.
17. Tao Z, Shi A, Lu C, Song T, Zhang Z, Zhao J.
Breast cancer: epidemiology and etiology. Cell
Biochem Biophys. 2015;72(2):333-8.
18. Marzouni HZ, Tarkhan F, Aidun A, Shahzamani
K, Tigh HR, Lashgarian HE. Cytotoxic eects of
coated gold nanoparticles on PC12 cancer cell.
Galen Med J. 2018;7:e1110.
19. Shahzamani K, Zare marzouni H, Tarkhan F,
Lashgarian H. A Study of Mechanism and Rate
of PC12 Cancer Cell Destruction Induced by
Lysine-Coated Gold Nanoparticle. J Babol Univ
Medical Sci. 2016;18(8):41-7.
20. Das S, Chatterjee M, Janarthan M, Ramachan-
dran H, Chatterjee M. Vanadium in cancer pre-
vention. Vanadium: Springer; 2012. p. 163-85.
21. Visalli G, Baluce B, Bertuccio M, Picerno I,
Di Pietro A. Mitochondrial-mediated apoptosis
pathway in alveolar epithelial cells exposed
to the metals in combustion-generated partic-
ulate matter. J Toxicol Environ Health Part A.
2015;78(11):697-709.
22. Öztürk E, Karaboğa Arslan AK, DOKUMACI
AH, Yerer MB. Real-time Analysis of Imped-
ance Alterations by the Eects of Vanadium
Pentoxide on Several Carcinoma Cell Lines.
Turk J Pharm Sci. 2018;15(1):1.
23. Tripathi D, Mani V, Pal RP. Vanadium in Bio-
sphere and Its Role in Biological Processes. Biol
Trace Elem Res. 2018:1-16.
24. Ray RS, Rana B, Swami B, Venu V, Chatterjee
M. Vanadium mediated apoptosis and cell cycle
arrest in MCF7 cell line. Chem Biol Interact.
2006;163(3):239-47.
25. Lujerdean C, Zăhan M, Dezmirean DS, Ștefan
R, Simedru D, Damian G, et al. In Vitro Studies
Demonstrate Antitumor Activity of Vanadium
Ions from a CaO-P2O5-CaF2: V2O5 Glass Sys-
tem in Human Cancer Cell Lines A375, A2780,
and Caco-2. Int J Mol Sci. 2023, 24(2): 1149.
26. Roy S, Banerjee S, Chakraborty T. Vanadium
quercetin complex attenuates mammary cancer
by regulating the P53, Akt/mTOR pathway and
downregulates cellular proliferation correlated
with increased apoptotic events. BioMetals.
2018:1-25.
27. Roy S, Chakraborty T. Deciphering the molec-
ular mechanism and apoptosis underlying the
in-vitro and in-vivo chemotherapeutic ecacy of
vanadium luteolin complex in colon cancer. Cell
Biochem Funct. 2018;36(3):116-28.
28. Othman AI, El-Sherbiny IM, ElMissiry MA, Ali
DA, AbdElhakim E. Polyphenon-E encapsulated
into chitosan nanoparticles inhibited prolifera-
tion and growth of Ehrlich solid tumor in mice.
Egypt J basic appl sci. 2018;5(1):110-20.
29. García-Rodríguez MD, Hernández-Cortés LM,
Altamirano-Lozano MA. In vivo eects of
vanadium pentoxide and antioxidants (ascorbic
acid and alpha-tocopherol) on apoptotic, cyto-
toxic, and genotoxic damage in peripheral blood
of mice. Oxid Med Cell Longev. 2016; 2016:
6797851.
