Received 2025-01-10

Revised 2025-02-09

Accepted 2025-03-15

Introduction

The term "Liver disease, or hepatic disease" applies to many illnesses and disorders that cause the liver to either function improperly or stop functioning completely [1]. When diagnosing or tracking the progression of liver disease or damage, a blood test known as a liver function test may be helpful. The tests measure the blood levels of certain enzymes or proteins [2]. Liver fibrosis is characterized by the accumulation of extracellular matrix proteins, which can lead to the formation of scar tissue and ultimately, cirrhosis [3]. The pathogenesis of liver fibrosis involves a range of cellular and molecular mechanisms, including the activation of hepatic stellate cells [3]. Additionally, insulin resistance and non-alcoholic fatty liver disease have been identified as significant risk factors for the development of liver fibrosis [1-3].

Many miRNAs are associated with systemic and organ-specific fibrosis in the liver. The expression of individual miRNA in plasma or serum is helpful for detecting liver fibrosis [4, 5]. MiR-98 (microRNA 98) is an RNA gene affiliated with the miRNA class. MiR-98 belongs to the let-7 miRNA family, which was first discovered to control the developmental timing of cell proliferation and differentiation in Celegans. MiR-98 are endogenous noncoding RNAs of about 22 nucleotides that bind to complementary sequences found in the 3-prime UTRs of target mRNAs, resulting in mRNA cleavage or translational suppression. Recently, altered expression of miR-98 has been found in several carcinomas [5, 6].

The MIR21 gene encodes microRNA 21, also called has-miRNA21 or miR-21, which is a microRNA found in mammals. The human microRNA-21 gene is located on the plus strand of chromosome 17q23.2 (55273409-55273480), inside a gene producing TMEM49 (also named vacuole membrane protein) [7, 8].

Its genetic targets have linked it to various illnesses, including neoplastic and non-neoplastic diseases. Tropomyosin 1, Phosphatase and Tensin Homolog (PTEN), and Programmed Cell Death 4 (PDCD4) are three of miR-21's primary targets [9, 10]. Studies have documented the increased expression of miRNAs, such as miR-21, in hepatitis and liver cancer. MiR-21's ability to induce fibrogenesis affects muscles and other organs, including the heart, lungs, kidneys, and liver [10, 11]. As the current understanding of liver fibrosis is hindered by the complexity of its pathological processes, including the involvement of epigenetics, and despite the recent emphasis on miRNAs like miRNA 21 and 98 in the era of epigenetics of liver diseases, there is still a significant gap in knowledge regarding the specific role of these miRNAs in the occurrence of liver fibrosis; We attempted to identify the potential miRNA 21 and 98 associated with hepatic fibrosis using RT-PCR-dependent gene expression, in addition to evaluating the liver function of fibrotic patients in our population.

Material and Methods

Study Design and Settings

This study employed a case-control design to investigate the relationship between liver fibrosis and molecular biomarkers. The study was conducted at Al-Diwaniyah Teaching Hospital, outpatient clinics, Medical City in Baghdad, and the Gastrointestinal Unit (GIT) at Al-Hakim Hospital/Najaf Al-Ashraf, from September 3, 2022, to October 15, 2023.

Eligibility Criteria

The study included 44 cases with liver fibrosis and 44 healthy controls. The cases were selected based on clinical diagnosis, and the controls were chosen from the same population to match the cases in terms of age and sex. The study used a 1:1 matching ratio, where each case was matched with a control of the same age and sex. The eligibility criteria for cases included a confirmed diagnosis of liver fibrosis, while the controls had no history of liver disease.

Outcomes, Exposures, Predictors, Potential Confounders, and Effect Modifiers

The primary outcome was the expression of miR-98 and miR-21 in liver fibrosis patients compared to healthy controls. The exposure of interest was liver fibrosis, and the potential confounders included age, sex, and hepatitis status. The diagnostic criteria for liver fibrosis were based on clinical and laboratory findings.

Data Sources/Measurement

The data sources included blood samples collected from participants, which were used for liver function tests, hepatitis tests, C-reactive protein tests, and molecular studies. The methods of assessment included immunoassays, chromatography, and quantitative real-time PCR (qRT-PCR). The assessment methods were comparable between cases and controls.

Molecular Study

RNA was extracted from blood samples using the TRIzol® reagent kit, according to the manufacturer's instructions. The extracted genomic RNA was checked using a Nanodrop Spectrophotometer, which verifies RNA concentration and estimates RNA purity by measuring absorbance at 260 nm and 280 nm wavelengths.

The extracted RNA was processed with DNase I enzyme to eliminate any small amounts of genomic DNA from the eluted total RNA. Following the method laid out by the Promega corporation in the United States of America, this procedure was executed utilizing samples and a DNase I enzyme kit. The reverse transcription step was then initiated, where the purified RNA was converted into complementary DNA using a reverse transcriptase enzyme, specifically the GoScript Reverse Transcriptase kit, in a 20 μL reaction mixture containing 1 μg of RNA, 1 μL of oligo(dT) primer, and 1 μL of reverse transcriptase, which was incubated at 42°C for 60 minutes to synthesize the first-strand cDNA. The qPCR primers for miR-98 (MIMAT0000096) and miR-21 (MIMAT0004495) were designed in this study using (the Sanger Center miRNA Database Registry) to select the miRNA sequence and the miRNA primer design tool. In this study, gene qPCR Housekeeping (GAPDH) (NM_001256799.3) was designed using NCBI-Database and Primer3 plus design online.

According to Table-1, these primers were supplied by the Macrogen company in Korea, which used the GoTaq® qPCR Master mix kit to make the qPCR master mix. Then, before being put in the Mini optic on the Real-Time PCR system, Using an ExiSpin vortex centrifuge, the components of the qPCR master mix were put into tubes for qPCR strip plate and mixed for three minutes. After that, the qPCR plate was loaded and subjected to the following mocycler protocol for miRNA genes or GAPDH genes within the following: the initial denaturation TM step at 95°C for 5 minutes (1 cycle), denaturation step2 at 95 °C for 20 seconds (45 cycles), annealing\extension/ detection (scanning) at 60 °C for 30 seconds (45 cycles). Relative quantification gene expression levels (the ΔCT technique using a reference gene) were utilized to analyze the qRT-PCR data for the target and housekeeping genes, as mentioned by Livak and Schmittgen [12]. Like the following equation:

∆CT (Test)=CT (target gene, test)– CT (the HKG gene, test)

∆CT (Control)=CT (target gene, control) – CT (HKG gene, control)

∆∆CT=∆CT (Test)– ∆CT (Control)

Fold change (target / HKG)=2-CT ∆∆CT

Statistical Analysis

The present research included SPSS IBM SPSS Statistics for Windows, version 19 (IBM Corp., Armonk, N.Y., USA), to analyze data. Qualitative data was compared by chi-square; while quantitative ones were compared by independent t test. Statistically significant associations were defined as differences lower than 0.05.

Ethical Approval

Approval was formally obtained from the hospital before starting work, and verbal consent was obtained from patients before collecting samples.

Result

The current research is a case-control study, that involved 44 patients suffering from liver fibrosis. As shown in Table-2, a comparison between cases and healthy controls revealed significant differences in various demographic and clinical properties. The mean age of cases was 61.16 ± 11.16 years, with a range of 29-78 years, whereas controls had a mean age of 55.6 ± 11.14 years, with a range of 25-76 years (P=0.226). The gender distribution showed that 68% of cases were males, compared to 59% in controls (P=0.077).

Additionally, cases had a higher mean BMI (34.36 ± 9.14 kg/m2) compared to controls (23.87 ± 2.87 kg/m2) (P=0.0486). Clinical assessments indicated that 16% of cases had hepatitis (P=0.017), 91% had chronic diseases (P=0.004), and 61% were smokers (P=0.038). Biochemical markers also showed significant differences, with cases having higher levels of TSB, ALP, ALT, AST, and CRP, and lower levels of albumin, compared to controls (P<0.05 for all). These findings suggest significant differences between cases and healthy controls in terms of demographic, clinical, and biochemical properties.

The results from the gene expression analysis (Figures-1 and -2) showed increased mean fold change (2-∆∆CT) for miRNA 21 in patients (1.14) compared to controls (0.33). At the same time, we found a lower mean fold change for miRNA 98 in patients (1.68) compared with healthy people, (6.30) which led to the emergence of significant differences (P<0.05) as in Table-3.

As shown in Table-4, the gene expression of miRNA 21 and miRNA 98 in the case group revealed significant differences based on sex and type of viral infection. Female cases had higher expression of miRNA 21 (1.082 ± 0.23) and miRNA 98 (1.895 ± 0.41) compared to males, with P values of 0.041 and 0.011, respectively. Additionally, cases infected with HBV had higher expression of miRNA 21 (1.201 ± 0.31) and miRNA 98 (2.985 ± 0.56) compared to those infected with HCV, with P values of 0.008 and <0.001, respectively.

Discussion

The present research found that the gene expression of miR-21 was higher in persons with liver fibrosis than healthy individuals. Nevertheless, there is variation and diversity in the expression of miR-21 in different kinds of liver disease, depending on the research. Several biological processes, including inflammation, fibrosis, and cancer, involve an upregulation of MiR-21. The significance of miR-21 in many liver illnesses is becoming increasingly shown by increasing evidence [13]. MiR-21 dysregulation is prevalent in several kinds of chronic hepatic diseases.

When considering miR-21 as a biomarker for certain liver illnesses or a treatment target, there are several possible problems to consider [14, 15].

Prior studies have shown that microRNAs produced by the host may regulate viral infections positively or negatively by targeting viral genomes or cellular components [16]. According to the current results, miRNA 21 and 98 levels were higher in those with HBV infection and lower in those with HCV infection.

Viral infections may affect the expression levels of cellular miRNA and provide a conducive environment for their survival and pathogenic effects. Studies have shown that levels of miR-21 in the blood serum of individuals infected with the Hepatitis B virus (HBV) were elevated [17, 18]. Though there was no conclusive evidence linking miR-21 to HBV infection or replication, certain studies indicated that miR-21 played a crucial role in the non-tumor to-tumor transformation induced by the HBV x protein (HBx). The transformation occurred through the PTEN/PI3K/Akt signaling pathway [19]. Our outcomes are similar to those of an earlier study that found that liver cells lines and fundamental humans liver cells exhibit an increase miR-21 when they are exposed to HCV [20]. Findings from a clinical study showed miR-21 expression in liver tissues was higher in increased viral loads and levels of fibrosis in HCV patients' liver biopsies [21].

The study by Chen et al. demonstrated that miR-21 has a role in negatively regulating the signaling of IFN-α during HCV infection by inhibiting the activity of myeloid differentiation primary response 88 (MyD88) and Interleukin1 Receptor Associated Kinase 1 (IRAK1) [22].

In the current study, gene expression of miRNA 98 was lower in fibrotic patients, especially males. In the same line, activated hepatic stellate cells (HSCs) and multiple hepatic fibrotic models demonstrated reduced miR-98 expression, according to research by Wang et al. [23]. In addition, the administration of miR-98 agomir reduced hepatic fibrosis and suppressed the expression of HLF in mice. Their research revealed that miR-98 protects liver fibrosis by specifically targeting HLF and controlling a novel signaling pathway, including HIF-1α, TGF-β, and Smad2/3 [23]. A possible predictor of liver fibrosis development was identified by the research conducted by Ma et al. [24] as miR-98-5p. Overexpression of miR-98-5p inhibited the activation of HSCs, whereas activated LX2 cells showed a decrease in miR-98. By interacting with TGFbR1 and blocking the TGFb1/Smad3 signaling pathway, MiR-98-5p inhibits liver fibrosis. In addition, 70 patients with chronic HBV infection and 29 healthy persons were measured in the study to test blood levels of miR-98. People with liver fibrosis had a much lower miR-98 in their serum than healthy controls and HBV carriers ]25[.

There is some evidence that miR-98-5p promotes cell apoptosis and inhibits hepatoma cell growth, at least in part, by inhibiting its target gene IGF2BP1]25[. According to another research, miR-98 inhibits glioma cell motility and invasion. It was also shown that miR-98 targets the IκB kinase IKKε in glioma cells ]26[. Nevertheless, there is a scarcity of studies regarding the role of miR-98-5p in the process of liver fibrosis. By targeting activating receptor-like kinase-4 and matrix metalloproteinase-11, siragam and colleagues discovered that miR-98 decreased breast cancer cells proliferation, growth, survival, invasion, and angiogenesis ]27[. Yang et al. found that miR-98 expression is down-regulated in non-small cell lung cancer, and P21-activated protein kinase 1 (PAK1) expression is significantly elevated [28].

Our study found that the mean fold change (2-∆∆CT) of genes miRNA 21 and miRNA 98 increased in females. This result confirms that the genetic expression of these genes is directly or indirectly linked to sex hormones, and in general we did not find sufficient studies to explain this. Szabo and Bala, in their study on miRNAs, indicated that the patient’s gender was associated with the gene expression of miRNAs [29].

Conclusion

The findings of the present investigation indicate that chronic diseases associated with obesity and smoking are the main causes of liver fibrosis. Genetically, miRNAs 21 and 98 have been linked to liver fibrosis, but in an opposite role, since an increase in the gene expression of miRNA 21 or a decrease in miRNA 98 coincides with the appearance of fibrosis, particularly in individuals infected by HBV. We also found a clear disturbance in liver function due to the high level of liver enzymes and CRP in patients compared to healthy people.

Conflict of Interest

No conflict of interest exists.

GMJ Copyright© 2025, Galen Medical Journal. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/) Email:gmj@salviapub.com

 Correspondence to: Baraa Jalil Saeed, Department of Biology, University of Al-Qadisiyha, Al Diwaniyah, Iraq. Telephone Number:+9647725945267 Email Address: sci.bio.ph.21.3@qu.edu.iq

GMJ.2025;14:e3833

www.salviapub.com

Saeed BJ, et al.

Evaluation of Gene Expression of Some miRNAs and Liver Functions in Fibrotic Patients

2	GMJ.2025;14:e3833 www.gmj.ir

Table 1. RT--PCR Primers with Their Sequence

Sequence (5’-3’)	Primer
GTCGTATCCAGTGCAGGGTCCGAGGT ATTCGCACTGGATACGACTTTTTTTTTTTVN	miRNA universal RT primers
AACCTCCTGAGGTAGTAAGTTGTAT	F	miR-98 qPCR primer
GTCGTATCCAGTGCAGGGT	R
AACAAGAGTTCTTCAGTGGCAAG	F	miR-21 qPCR primer
GTCGTATCCAGTGCAGGGT	R
TCACCAGGGCTGCTTTTAAC	F	GAPDH qPCR primer
TGACGGTGCCATGGAATTTG	R

Evaluation of Gene Expression of Some miRNAs and Liver Functions in Fibrotic Patients

Saeed BJ, et al.

GMJ.2025;14:e3833 www.gmj.ir

3

Saeed BJ, et al.

Evaluation of Gene Expression of Some miRNAs and Liver Functions in Fibrotic Patients

4	GMJ.2025;14:e3833 www.gmj.ir

Table 2. Comparison of Demographic, Clinical, and Biochemical Properties between Cases and Healthy Controls

Properties	Cases N=44	Control N=44	P-value
Age range	29 - 78	25 - 76	-
Mean Age ± SD	61.16 ± 11.16	55.6 ± 11.14	0.226
Gender (Males)	30 (68%)	26 (59%)	0.077
Gender (Females)	14 (32%)	18 (41%)	0.077
BMI (Kg/M2) (Mean ± SD)	34.36 ± 9.14	23.87 ± 2.87	0.0486
Hepatitis	7 (16%)	-	-
Chronic diseases	40 (91%)	-	-
Smoking	27 (61%)	17 (39%)	0.038
TSB (mg/dl) (Mean ± SD)	15.3 ± 2.50	0.488 ± 0.09	0.031
ALP (U/L) (Mean ± SD)	370 ± 108.59	122.56 ± 10.96	0.022
ALT (U/L) (Mean ± SD)	42.36 ± 5.97	26.36 ± 4.95	0.037
AST (U/L) (Mean ± SD)	47.76 ± 2.96	11.92 ± 2.16	0.019
Albumin (g/dl) (Mean ± SD)	1.78 ± 0.42	3.90 ± 0.44	0.0219
CRP (mg/L) (Mean ± SD)	15.45 ± 2	6.76 ± 0.828	0.043

Evaluation of Gene Expression of Some miRNAs and Liver Functions in Fibrotic Patients

Saeed BJ, et al.

GMJ.2025;14:e3833 www.gmj.ir

5

Table 3. Comparison Mean of Gene Expression of miRNA 21, 98 between Cases and Control

Gene expression	Case-control	Mean CT(gene)	Mean CT(gapdh)	Mean ∆CT(test)	Mean ∆CT(control)	Mean Fold change (2-∆∆CT)
miRNA 21	Cases	29.6	27.2	-2.38	2.38	1.14
	Control	27.6	27.8	-0.145	2.38	0.33
miRNA 98	Cases	26.16	27.23	-1.08	-1.08	1.68
	Control	28.95	27.78	1.17	-1.08	6.30

significant association in compared with controls (P<0.05)

Saeed BJ, et al.

Evaluation of Gene Expression of Some miRNAs and Liver Functions in Fibrotic Patients

6	GMJ.2025;14:e3833 www.gmj.ir

Table 4. Gene Expression of miRNA 21 and miRNA 98 in Case Group

Category	miRNA 21 (Mean ± SD)	P-value	miRNA 98 (Mean ± SD)	P-value
Female	1.082 ± 0.23	0.041	1.895 ± 0.41	0.011
Male	0.921 ± 0.17		1.234 ± 0.29
HBV	1.201 ± 0.31	0.008	2.985 ± 0.56	<0.001
HCV	0.883 ± 0.21		0.310 ± 0.15

Evaluation of Gene Expression of Some miRNAs and Liver Functions in Fibrotic Patients

Saeed BJ, et al.

GMJ.2025;14:e3833 www.gmj.ir

7

References

1. Zhang CY, Yuan WG, He P, et al. Liver fibrosis and hepatic stellate cells: Etiology, pathological hallmarks and therapeutic targets. World J Gastroenterol. 2016;22(48):10512-10522.
2. Bataller R, Brenner DA. Liver fibrosis. J Clin Investig. 2005;115:209–218.
3. Scott J, Jones AM, Piper Hanley K, Athwal VS. epidemiology, pathogenesis and management of liver disease in adults with cystic fibrosis. Alimentary pharmacology & therapeutics. 2022 Feb;55(4):389-400.
4. Fan HX, Tang H. Complex interactions between microRNAs and hepatitis B/C viruses. World J Gastroenterol. 2014; 20:13477–13492.
5. Liu X, Ma H, Wu R, et al. Identification of Liver Fibrosis-Related MicroRNAs in Human Primary Hepatic Stellate Cells Using High-Throughput Sequencing. Genes (Basel). 2022;13(12):2201.
6. Wang Q, Wei S, Zhou H, et al. MicroRNA-98 Inhibits Hepatic Stellate Cell Activation and Attenuates Liver Fibrosis by Regulating HLF Expression. Front Cell Dev Biol. 2020;8:513.
7. Liu G, Friggeri A, Yang Y, et al. miR-21 mediates fibrogenic activation of pulmonary fibroblasts and lung fibrosis. J Exp Med. 2010;207(8):1589-1597.
8. Chau BN, Xin C, Hartner J, et al. MicroRNA-21 promotes fibrosis of the kidney by silencing metabolic pathways. Sci Transl Med. 2012;4(121):121ra18.
9. Caviglia JM, Yan J, Jang MK, et al. MicroRNA-21 and Dicer are dispensable for hepatic stellate cell activation and the development of liver fibrosis. Hepatology. 2018;67(6):2414-2429.
10. Beermann J, Piccoli MT, Viereck J, Thum T. Non-coding RNAs in Development and Disease: Background, Mechanisms, and Therapeutic Approaches. Physiol Rev. 2016;96(4):1297-1325.
11. Patrick DM, Montgomery RL, Qi X, et al. Stress-dependent cardiac remodeling occurs in the absence of microRNA-21 in mice. J Clin Invest. 2010;120(11):3912-3916.
12. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402-408.
13. Kumarswamy R, Volkmann I, Thum T. Regulation and function of miRNA-21 in health and disease. RNA Biol. 2011;8(5):706-713.
14. Zhu H, Luo H, Li Y, et al. MicroRNA-21 in scleroderma fibrosis and its function in TGF-β-regulated fibrosis-related genes expression [published correction appears in . J Clin Immunol. 2013 Aug;33(6):1143-4.
15. Ludwig N, Leidinger P, Becker K, et al. Distribution of miRNA expression across human tissues. Nucleic Acids Res. 2016;44(8):3865-3877.
16. Sarnow P, Jopling CL, Norman KL, et al. MicroRNAs: expression, avoidance and subversion by vertebrate viruses. Nat Rev Microbiol. 2006;4(9):651-659.
17. Damania P, Sen B, Dar SB, et al. Hepatitis B virus induces cell proliferation via HBx-induced microRNA-21 in hepatocellular carcinoma by targeting programmed cell death protein4 (PDCD4) and phosphatase and tensin homologue (PTEN). PLoS One. 2014;9(3):e91745.
18. Caviglia JM, Yan J, Jang MK, et al. MicroRNA-21 and Dicer are dispensable for hepatic stellate cell activation and the development of liver fibrosis. Hepatology. 2018;67(6):2414-2429.
19. Hou Z, Quan J. Hepatitis B virus X protein increases microRNA-21 expression and accelerates the development of hepatoma via the phosphatase and tensin homolog/phosphoinositide 3-kinase/protein kinase B signaling pathway. Mol Med Rep. 2017;15(5):3285-3291.
20. Bandiera S, Pernot S, El Saghire H, et al. Hepatitis C Virus-Induced Upregulation of MicroRNA miR-146a-5p in Hepatocytes Promotes Viral Infection and Deregulates Metabolic Pathways Associated with Liver Disease Pathogenesis. J Virol. 2016;90(14):6387-6400.
21. Marquez RT, Bandyopadhyay S, Wendlandt EB, et al. Correlation between microRNA expression levels and clinical parameters associated with chronic hepatitis C viral infection in humans. Lab Invest. 2010;90(12):1727-1736.
22. Chen Y, Chen J, Wang H, et al. HCV-induced miR-21 contributes to evasion of host immune system by targeting MyD88 and IRAK1. PLoS Pathog. 2013;9(4):e1003248.
23. Wang Q, Wei S, Zhou H, et al. MicroRNA-98 Inhibits Hepatic Stellate Cell Activation and Attenuates Liver Fibrosis by Regulating HLF Expression. Front Cell Dev Biol. 2020;8:513.
24. Ma Y, Yuan X, Han M, et al. miR-98-5p as a novel biomarker suppress liver fibrosis by targeting TGFβ receptor 1. Hepatol Int. 2022;16(3):614-626.
25. Jiang T, Li M, Li Q, Guo Z, Sun X, Zhang X, et al. MicroRNA-98-5p Inhibits Cell Proliferation and Induces Cell Apoptosis in Hepatocellular Carcinoma via Targeting IGF2BP1. Oncol Res. 2017 Aug 7;25(7):1117-1127.
26. Fan YH, Ye MH, Wu L, et al. Overexpression of miR-98 inhibits cell invasion in glioma cell lines via downregulation of IKKε. Eur Rev Med Pharmacol Sci. 2015;19(19):3593-3604.
27. Siragam V, Rutnam ZJ, Yang W, et al. MicroRNA miR-98 inhibits tumor angiogenesis and invasion by targeting activin receptor-like kinase-4 and matrix metalloproteinase-11. Oncotarget. 2012;3(11):1370-1385.
28. Yang G, Zhang X, Shi J. MiR-98 inhibits cell proliferation and invasion of non-small cell carcinoma lung cancer by targeting PAK1. Int J Clin Exp Med. 2015;8(11):20135-20145.
29. Szabo G, Bala S. MicroRNAs in liver disease Nature reviews. Gastroenterology & hepatology. 2013; 10(9): 542–552.

Saeed BJ, et al.

Evaluation of Gene Expression of Some miRNAs and Liver Functions in Fibrotic Patients

8	GMJ.2025;14:e3833 www.gmj.ir