Antimicrobial Effect of Silver Nanoparticles on Staphylococcus Aureus

Mohammad Soleimani, Maziar Habibi-Pirkoohi

Department of Microbiology, Faculty of Medicine, AJA University of Medical Sciences, Tehran, Iran

Introduction

Silver nanoparticles (SNPs) are currently used in a large number of medical applications ranging from diagnosis and drug delivery to medical device dressing and, more notably, development of new generation of antibiotics [1]. Furthermore, potent antibacterial, antifungal and antiviral properties of SNPs have nominated them as a promising alternative to commercially available antibiotics [2].

Due to the emergence and global spread of bacterial strains resistant to multiple antibiotics, and the continuing emphasis on health-care costs, many researchers have tried to develop a new generation of antimicrobial medicines free of resistance and cost [3]. Nanoparticles are of great interest due to their slight size, and a large surface to volume ratio, which provides them with unique mechanical, catalytic and biological properties [4]. The preparation of nanoparticle-based medicines with a unique size, shape and chemical properties is great potential in the formulation of new pharmaceutical products [5]. It is well established that medical formulations in the form of nanoparticles can be used as effective antimicrobial compounds. Therefore, preparation, characterization, modification, and functionalization of metal nanoparticles pave the road for the formulation of new bactericidal medicines [6]. Antimicrobial properties of SNPs against a large number of infectious bacteria explain the wide application of these particles in various fields of medicine, different industries, animal husbandry, packaging, accessories, cosmetics, health, and military [3, 6, 7].

Although inhibitory effects of SNPs have been widely studied, the majority of the studies have been focused mainly on the inhibitory effect of SNPs on the growth of bacteria and hence, there is a significant gap about antagonistic effects of SNPs on virulence factors of the pathogenic microorganisms. The capsule is a common virulence factor among many pathogenic bacteria including Staphylococcus aureus. Bacteria that cause clinical disease, produce extracellular capsular structures [8]. Capsules enhance microbial virulence by rendering the bacterium resistant to immune responses of the host. Type 8 capsular polysaccharide (CP8) is the most prevalent capsule type in clinical isolates of S. aureus [9]. The S. aureus is a Gram-positive human pathogen that causes serious infections and diseases associated with significant morbidity and mortality. The occurrence of new drug-resistant strains of this pathogen- as a result of unharnessed use of antibiotics- is currently a major challenge for both patients and medical communities [9].

Biosynthesis of metal nanoparticles by different classes of plants is considered as a cost-effective, environmentally benign and time-saving approach for eco-friendly production of various types of metal nanoparticles [10]. Microalgae constitute a diverse group of unicellular plants that growth fast and produce a large volume of biomass in a fairly short time. These properties make them an ideal choice for biosynthesis of metal nanoparticles [11].

The main goal of the present study was to investigate the utility of SNPs as a new generation of antibiotic against S. aureus. For this purpose, two objectives were sought: 1- to evaluate the utility of green microalgae Chlorella vulgaris in the biosynthesis of SNPs as a quick and cost-effective system; 2- to investigate the inhibitory effect of biologically synthesized SNPs on the growth of S. aureus and expression of the type 8 capsule (cap8) gene as the main virulence factor of this infectious bacterium.

Materials and Methods

Biosynthesis of SNPs

To prepare silver nitrate stock, 3.39gr of AgNO3 was dissolved in 100ml sterile water to give a 200mM solution. A healthy culture of C. vulgaris was harvested in logarithmic phase and centrifuged at 5000 rpm for 15 min at 4oC. After discarding the supernatant, the biomass was washed with sterile water for three times to remove culture medium ingredients. The biomass was re-suspended in 47.5 ml of distilled water. Then, 2.5ml of the 200mM AgNO3 solution was added to get a final 10mM concentration. The bioreduction medium was incubated at 25oC for 48h. A 50ml suspension of C. vulgaris free of AgNO3 was used as a control.

Characterization

Bioreduction of silver ions to SNPs was monitored by measuring the UV-Vis spectra of the solution over the range between 300 to 500nm using Spectrophotometer. Morphology of the SNPs was studied using transmission electron microscopy (TEM) using Leo 912 AB high-resolution TEM operating at an accelerating voltage of 120 kV. A sample of the aqueous biomass solution was placed on the carbon-coated copper grid and dried prior to microscopy. For X-ray diffractometer (XRD) measurement, a sample of bioreduction solution was spread in a petri dish and oven dried. The dried sample was taken for XRD analysis using PHILIPS PW1480 X-ray diffractometer (Netherlands). The concentration of biosynthesized SNPs was measured by high-resolution ICP-OES spectrometer (SPECTRO ARCOS, Germany).

Antimicrobial Assay

The S. aureus (PTTC 1431) was provided by Mashhad University of Medical Science, Iran. Minimum inhibitory concentration (MIC) of the biologically synthesized SNPs was determined using broth microdilution method in a 96-well standard ELISA plate. Luria Bertani (LB) broth containing 105 CFU/ml of S. aureus cells was used as a culture medium. The final concentrations of SNPs used in this assay were 0, 12.5, 25, 50, and 100μg/ml. No SNP was added to negative control well. The lowest concentration of SNPs inhibiting bacterial growth was assigned as MIC. For further evaluation of the influence of SNPs on S. aureus, the growth kinetics of S. aureus in a 6h period was monitored. For this purpose, bacterial growth curve at 0, 12.5, 25, 50, and 100μg/ml of SNPs was plotted by measuring optical density (600nm) against three 2h time intervals. The growth curve was drawn using Excel software.

Real-Time Polymerase Chain Reaction (PCR) Assay

Real-Time PCR assay was conducted to assess expression of cap8 gene after two hours of SNPs treatment. RNA isolation and cDNA synthesis was carried out following general procedure. Primer pair sequences for Real-Time PCR of the virulence factor were designed by AllelID 6.0 software as follows: 5ˊAGCCGTTAATCCGCCTAATGTC3ˊ (forward) and 5ˊACTGGACCACCCGCTTCG3ˊ (reverse). The 16s RNA was used as housekeeping (reference) gene and internal control in Real-Time PCR assay. Forward and reverse sequences of the reference gene were 5’- CGTGCTACAATGGACAATACAAA-3’ and 5’- ATCTACGATTACTAGCGATTCCA-3’; respectively [12]. Expression of the virulence gene (cap8) was quantitatively analyzed using a Real-Time PCR system (BioRad). Real-Time PCR was carried out in a 20 μL reaction volume containing 0.5μM of each primer and 10μl of SYBR Green Real-time PCR Master mix (Genet Bio, South Korea). Quantitative Real-Time PCR experiments were performed in duplicate for each sample. The Real-Time RT-PCR data were analyzed by the (ΔΔCt) method as described by Xiang et al. [12].

Results

Characterization SNPs

A quick and traceable change was observed in bio reduction medium after addition of silver nitrate into C. vulgaris broth culture. In UV-Vis Spectroscopy, a surface plasmon resonance peak was observed at about 450nm which confirms the formation of SNPs (Figure-1). The TEM microscopy revealed that the SNPs are of spherical shape with size about 10nm (Figure-2). Moreover, TEM image showed monodispersity of the biosynthesized SNPs with only a few particles had different size. Energy Dispersive Spectrometry (EDS) assay indicated a sharp signal for Ag confirming biosynthesis of SNPs (Figure-3). An absorption peak at 3keV confirmed the presence of SNPs. The XRD results showed peaks corresponding to (111), (200), (220) and (322) Bragg reflections (Figure-4). This pattern coincides with unique peaks of silver; confirming the presence of SNPs in the sample. According to Joint Committee on Powder Diffraction Standards (JCPDS), four XRD peaks observed in this study indicate that the biosynthesized SNPs are pure crystalline silver. The concentration of the biosynthesized SNPs was determined using inductively-coupled plasma (ICP) method. Results showed that the concentration of SNPs in a 25ml sample containing both SNPs and algal biomass was 2.934mg/l in average.

Antimicrobial Assay

A typical serial microdilution assay was used to evaluate the inhibitory effect of SNPs on the growth of S. aureus. Results of this test showed that SNPs at the concentration of 50μg/ml could inhibit the growth of the pathogen; the MIC of the SNPs was therefore determined as 50μg/ml. Bacterial suspension showed normal growth below MIC value. Bacterial growth was also normal at negative control well.

The growth kinetics of S. aureus under treatment with different concentrations of SNPs is presented in Figure-5. The control group showed a rapid growth pattern which followed an ascending trend until the end of the assay. In contrast, at all SNP concentrations, bacterial growth followed a descending trend; so that at the end of the assay (six hours), bacterial growth in all treatments was nearly zero. The growth decreasing was more severe in the sample treated with 100μg/ml of SNPs, so that a drop of growth was observed only after 2 hours.

The SNPs Decreased the Expression of cap8 mRNA

Influence of SNPs on cap8 – as a virulence factor of S. aureus- was studied via Real-Time PCR. Results of Real-Time PCR are presented in Figure-6. As could be seen, a dose-dependent decrease in expression of cap8 under treatment with various concentrations of SNPs was recorded. In the range of 0 to 100μg/ml of SNPs, a nearly linear relation was observed between SNPs concentration and reduction of cap8 expression.

Discussion

In the current research, the antimicrobial effect of SNPs on S. aureus growth and expression of the cap8 gene was studied. Characterization assays indicated that circular SNPs with good monodispersity were produced by incubation of C. vulgaris with silver nitrate. This finding is agreement with previous studies that reported the efficacy of unicellular microalgae for biosynthesis of various types of metal nanoparticles [13, 14, 15]. Although the exact mechanism of nanoparticle production by microalgae is not fully understood [16], some potential processes have been proposed to explain this biological synthesis. The most probable mechanism is secretion of cellular reductases into growth medium by microalgal cells. These enzymes can efficiently reduce silver ions into SNPs [17, 18]. Moreover, metal ions can be trapped by the carboxylate groups residing on the surface of microalgal cells. The entrapped ions are then reduced by reductase enzymes which subsequently results in the formation of nanoparticles [19]. Monodisperse spherical nanoparticles with small size (~10nm) were generated in this experiment. The small size of SNPs provides a higher surface area that promotes their reactivity and hence, enhances their antibacterial potential. In fact, the size-dependent interaction of SNPs with pathogenic bacteria and viruses has been reported by many authors [6, 20, 21, 22]. An absorption peak at 3keV in EDS study confirmed the presence of SNPs in the solution. The XRD pattern obtained in this study was in accordance with previously determined Bragg reflections associated with SNPs [14, 23]. Particularly, it has been reported that the reactivity of SNPs is favored by high-atom-density facets such as (111) [24].

Following the main goals of this experiment, we investigated inhibitory effects of the biologically synthesized SNPs on the growth of the highly infectious bacterium S. aureus and expression of cap8 gene cluster as a major virulence factor of the bacterium. Results of microdilution assay showed that SNPs could fully inhibit bacterial growth at a concentration of 50μg/ml. This finding is in line with previous studies demonstrating antibacterial properties of SNPs [6, 20, 25, 26].

In contrast to many of previous studies limited to evaluation of the SNPs effect on bacterial growth, we extended our research by quantification of cap8 gene expression under treatment with SNPs. The results obtained in Real-Time PCR assay showed that SNPs, even at an as low concentration as 12.5μg/ml, decrease cap8 expression. Again, a dose-dependent behavior was observed for antagonistic effects of SNPs on the expression of this virulence gene. This finding is of great biomedical importance because it shows that SNPs not only inhibit growth but also negatively affect the expression of a virulence factor of S. aureus. As mentioned by Ragle and Wardenburg, neutralization of the main virulence factors is an effective way to find effective preventative and therapeutic agents to combat staphylococcal infection [27].

Silver occupies a high position among inorganic antibacterial agents. Infectious bacteria are unlikely to develop resistance against silver because this metal has a negative impact on a broad range of targets in the bacteria, suggesting that pathogens have to develop a large number of mutations simultaneously to protect themselves [3]. Our results are also in line with those reported by Li et al. (2012) that found out that dressing endotracheal tube coated with silver is highly effective in preventing ventilator-associated pneumonia among adults [28]. Moreover, compared to bulk metal silver, SNPs are safe and nontoxic; thus they can be widely used dressing agents in manufacturing various medical devices ranging from dental bandages, catheters, and bone cement [1] to cardiovascular implants [29]. Particularly, regarding inhibitory effects of SNPs on growth and virulence properties of S. aureus, these nanoparticles can be effectively used in the development of wound dressings for curing staphylococcal skin infections.

Conclusion

The results of this research revealed the potential utility of SNPs in formulating new antimicrobial drugs addressing the problem of occurrence of resistant bacterial strains. Medical implications of these results may include the development of silver-based creams and ointments for curing staphylococcal lesions, new types of disinfecting solutions, silver-containing dressings in treating burns, dressing endotracheal tubes and urinary catheters, and dental instruments and bandages.

Conflict of Interest

There is no conflict of interest.